LC Sciences Metagenomics Sequencing Report



Customer Name#######
Customer Institutaion#######
Customer Email#######
Project ID#######
SalespersonKyle Navel
Emailknavel@lcsciences.com

Your reliable partner in genomics, transcriptomics and proteomics


1. Introduction


Metagenomics is the study of genetic material recovered directly from environmental samples. The broad field may also be referred to as environmental genomics, ecogenomics or community genomics. While traditional microbiology and microbial genome sequencing and genomics rely upon cultivated clonal cultures, early environmental gene sequencing cloned specific genes (often the 16S rRNA gene) to produce a profile of diversity in a natural sample. Such work revealed that the vast majority of microbial biodiversity had been missed by cultivation-based methods. Recent studies use either "shotgun" or PCR directed sequencing to get largely unbiased samples of all genes from all the members of the sampled communities. Because of its ability to reveal the previously hidden diversity of microscopic life, metagenomics offers a powerful lens for viewing the microbial world that has the potential to revolutionize understanding of the entire living world. As the price of DNA sequencing continues to fall, metagenomics now allows microbial ecology to be investigated at a much greater scale and detail than before.



The first metagenomic studies conducted using high-throughput sequencing used massively parallel 454 pyrosequencing. Three other technologies commonly applied to environmental sampling are the Ion Torrent Personal Genome Machine, the Illumina MiSeq or HiSeq and the Applied Biosystems SOLiD system. These techniques for sequencing DNA generate shorter fragments than Sanger sequencing; Ion Torrent PGM System and 454 pyrosequencing typically produces ~400 bp reads, Illumina MiSeq produces 400-700bp reads (depending on whether paired end options are used), and SOLiD produce 25-75 bp reads. Historically, these read lengths were significantly shorter than the typical Sanger sequencing read length of ~750 bp, however the Illumina technology is quickly coming close to this benchmark. However, this limitation is compensated for by the much larger number of sequence reads. In 2009, pyrosequenced metagenomes generate 200–500 megabases, and Illumina platforms generate around 20–50 gigabases, but these outputs have increased by orders of magnitude in recent years. An additional advantage to high throughput sequencing is that this technique does not require cloning the DNA before sequencing, removing one of the main biases and bottlenecks in environmental sampling.



2. Materials and Methods


2.1 Library construction and sequencing


DNA extractions:

DNA from different samples was extracted using The E.Z.N.A.® Stool DNA Kit (D4015-02, Omega, Inc., USA) according to manufacturer’s instructions. The reagent which was designed to uncover DNA from trace amounts of sample has been shown to be effective for the preparation of DNA of most bacteria. Sample blanks consisted of unused swabs processed through DNA extraction and tested to contain no DNA amplicons. The total DNA was eluted in 50 µl of Elution buffer by a modification of the procedure de-scribed by manufacturer (QIAGEN) and stored at -80°C until measurement in the PCR by LC Sciences.


DNA Library Construction and sequencing:

DNA library was constructed by TruSeq Nano DNA LT Library Preparation Kit (FC-121-4001) . DNA was fragmented by dsDNA Fragmentase(NEB, M0348S) by incubate at 37°C for 30min. Library construction begins with fragmented cDNA. Blunt-end DNA fragments are generated using a combination of fill-in reactions and exonuclease activity, and size selection is performed with provided sample purification beads. An A-base is then added to the blunt ends of each strand, preparing them for ligation to the indexed adapters.Each adapter contains a T-base overhang for ligating the adapter to the A-tailed fragmented DNA. These adapters contain the full complement of sequencing primer hybridization sites for single, paired-end, and indexed reads. Single- or dual-index adapters are ligated to the fragments and the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8cycles of denaturation at 98℃ for 15 sec, annealing at 60℃ for 15 sec, and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. And then we performed the paired-end sequencing on an Illumina Hiseq 4000 at LC Sciences following the vendor's recommended protocol.



2.2 Bioinformatics analysis


Raw sequencing reads were processed to obtain valid reads for further analysis. First, sequencing adapters were removed from sequencing reads using cutadapt v1.9 [1]. Secondly, low quality reads were trimmed by fqtrim v0.94 using a sliding-window algorithm. Thirdly, reads were aligned to the host genome using bowtie2 [2] to remove host contamination. Once quality-filtered reads were obtained, they were de novo assembled to construct the metagenome for each sample by SPAdes v3.10.0 [3]. All coding regions (CDS) of metagenomic contigs were predicted by MetaGeneMark v3.26.


CDS sequences of all samples were clustered by CD-HIT v4.6.1 [4] to obtain unigenes. Unigene abundance for a certain sample were estimated by TPM based on the number of aligned reads by bowtie2 v2.2.0 [2]. The lowest common ancestor taxonomy of unigenes were obtained by aligning them against the NCBI NR database by DIAMOND v 0.7.12 [5]. Similarly, the functional annotation(GO, KEGG, eggnog, CAZy, CARD, PHI) of unigenes were obtained. Based on the taxonomic and functional annotation of unigenes, along with the abundance profile of unigenes, the differential analysis were carried out at each taxonomic or functional or gene-wise level by Fisher's exact test(non-replicated groups) or Kruskal-Wallis test(replicated groups).



Bioinformatics pipeline for megagenomics


Reference:

1. Martin M (2011) Cutadapt removes adapter sequences from high-throughput sequencing reads. Embnet Journal 17.

2. Langmead B, Salzberg SL (2012) Fast gapped-read alignment with Bowtie 2. Nature Methods 9: 357-359.

3. Bankevich, A., et al. (2012). SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing. Journal of Computational Biology, 19(5), 455.

4. Li, W., & Godzik, A. (2006). CD-HIT: a fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics, 22(13), 1658.

5. Buchfink, B., Xie, C., & Huson, D. H. (2015). Fast and sensitive protein alignment using DIAMOND. Nature Methods, 12(1), 59.




3. Project information


3.1 Sample information


Sample type: human intestinal

Objects: bacteria/archaea/fungus/virus

3.2 Database


Dababase Web links Version/date
Gene Ontology (GO)http://geneontology.org/2016.12
KEGGhttp://www.genome.jp/kegg/2016.12
NR databaseftp://ftp.ncbi.nlm.nih.gov/blast/db/FASTA/nr.gz2017.04
eggNOGhttp://eggnogdb.embl.de/download/4.5
CARDhttps://card.mcmaster.ca/download2016.06
CAZyhttp://www.cazy.org/2016.06
PHIhttp://www.phi-base.org/4.1

3.3 Bioinformatics software


Analysis item Software Version/date
Quality controlFastQC0.10.1
Adapter removeCutadapt1.10
Low quality reads removefqtrim0.94
host genome filterbowtie22.2
AssemblySPAdes3.7
Statistics of assembled contigsQUAST3.2
alignmentDIAMOND0.7.12
Annotationscripts in houseNA


4. Overview of results


4.1 Sample information


#SampleIDGroup
CON001control
CON002control
CON003control
DLF001stage1
DLF002stage1
DLF003stage1
T2D001stage2
T2D002stage2
T2D003stage2

document location: summary/1_rawdata/sample_map.xlsx


4.2 Quality control


SampleRaw DataValid DataValid%Q20%Q30%GC%
ReadBaseReadBase
CON001441422483.97G423639943.72G95.9798.6294.9146.92
CON002477938044.30G446675283.50G93.4696.1888.4044.07
CON003452683844.07G423749603.32G93.6196.0688.2445.62
DLF001332301542.46G300991722.18G90.5897.7493.1640.95
DLF002204472081.51G181374381.30G88.7096.9591.7643.91
DLF003269640882.00G244336061.76G90.6297.2893.3844.82
T2D001482511164.34G455736283.98G94.4598.2492.9746.03
T2D002518452864.67G484976384.24G93.5498.2592.0843.84
T2D003583335425.25G544620664.74G93.3698.1391.5644.15

document location: summary/2_CleanData/DEMO_data_stat.xlsx


4.3 Assembly


4.3.1 Results of assembly


We utilize metaSPAdes (http://bioinf.spbau.ru/en/spades3.7) to assemble reads of each sample into contigs first. Then we merged all samples into a "MIX" sample and continued to assemble "MIX" sample. The final result with FASTA format was deposited in summary/3_Assembly. Only those sequences longer than 500nt would be remained.


Example:


NODE 1 length 299711 cov 17.4623 ID 9988

AACCTAAAACTCCTGTAAGAAGAAGCGCCCCTAGAAATTGAGTCATCTTATCACCTACTTTTTATTTTATTATAACACATTTAGTACCTAGTACTAAATT

ACGGGTAGCCCGACTACCCTTATTATTTTTTAATATTTTATAGAACATACGTTCTTGCAGGAGGTATAAACATGTGGATTGAAAAATTTAAAAACAAAAAT

AACGAAACTAAATACAGATACTACGAGAAGTATAAAGAT...


Explaination: NODE 1=serial number; length 299711=length of contigs; cov 17.4623=coverage of maximum kmer


document location: summary/3_Assembly/*/contigs.min500.fasta


4.3.2 Statistics of assembled results



document location:

summary/3_Assembly/assembly_stats.html

summary/3_Assembly/assembly_stats.xlsx


4.4 Gene prediction and abundance estimation


4.4.1 Abundance estimation


Coding regions (CDS) of assembled contigs were predicted by MetaGeneMark and those contigs shorter than 100nt were removed. CD-HIT was utilized to produce a set of non-redundant and to output a cluster file (identity=95%, coverage=90%). Counts of each unigene was calculated by bowtie2 through mapping reads of each sample on unigene. Abundance estimation was calculated by TPM as shown below.



counts of unigene:

Unigene_IDCON001CON002CON003DLF001DLF002DLF003T2D001T2D002T2D003
Unigene1134000011020
Unigene2227050020000
Unigene3291452000000
Unigene491720218310
Unigene550013000210
Unigene61004000000
Unigene7356135025010
Unigene8101022000010
Unigene9149228001000
Unigene106508002100
Unigene11109652614022250661406
Unigene1222600007000
Unigene1328324212357396543372488
Unigene143926031100
Unigene154007062000
Unigene161362150226000
Unigene171171140123000
Unigene18107023005102
Unigene19144025009000
Unigene205527002031
Unigene2116100003010
Unigene2285019000000
Unigene231400000000
Unigene2410500402000
Unigene2510200000000
Unigene26670001520000
Unigene27850002182000
Unigene28690002360000
Unigene29470101401000
Unigene301830000000
Unigene3116900004000
Unigene322800000000
Unigene3316000000330
Unigene34770000102560
Unigene35670000402010
Unigene3610113103001
Unigene375300000000
Unigene388900000200
Unigene395100000000
Unigene40306000012300
Unigene412601000000
Unigene4210727043100
Unigene437848086140
Unigene44131153522010000
Unigene452121031000
Unigene464800107010
Unigene4774030015100
Unigene483035111129100
Unigene498300008000
Unigene504124083000
Unigene5151400018000
Unigene523314031000
Unigene534402052110
Unigene5410288071001
Unigene55481660281842011
Unigene56602160017100
Unigene57431000013000
Unigene5880041000010
Unigene59530026700018
Unigene607500214310031
Unigene614000013600035
Unigene62219110140003
Unigene635000000000
Unigene6473407003151021
Unigene6513700004000
Unigene6612400001100
Unigene67248321210085100
Unigene6817715690045000
Unigene691913420129101
Unigene7092404823820491650
Unigene71131194036270
Unigene72199000110000
Unigene7397160101000
Unigene745171406215130
Unigene756085016013100
Unigene766714141611003
Unigene77108121705211400
Unigene78606101021300
Unigene7910515140430700
Unigene80226833121457720
Unigene8171291518291803
Unigene821047140024302
Unigene83571170118603
Unigene8431160113100
Unigene85131613053200
Unigene864732010000
Unigene875216041000
Unigene881703000000
Unigene89117817254322
Unigene90200029004000
Unigene91137028100000
Unigene9256013000001
Unigene93900000180630
Unigene9421700003421550
Unigene9513000030120
Unigene96220070019000
Unigene97161090114000
Unigene985502006000
Unigene9910300006000

document location: summary/4_GenePredict/4_Unigenes_count.txt



TPMs of unigene:

Unigene_IDCON001CON002CON003DLF001DLF002DLF003T2D001T2D002T2D003
Unigene18.120.000.000.000.001.260.000.110.00
Unigene25.100.000.120.000.000.850.000.000.00
Unigene35.970.081.120.000.000.000.000.000.00
Unigene48.370.020.000.030.020.140.030.010.00
Unigene51.860.000.510.000.000.000.070.040.00
Unigene61.020.000.430.000.000.000.000.000.00
Unigene74.440.010.460.000.060.120.000.010.00
Unigene85.680.001.300.000.000.000.000.050.00
Unigene95.330.071.050.000.000.070.000.000.00
Unigene103.580.000.460.000.000.210.050.000.00
Unigene112.951.770.7456.388514.80320.001.683.580.14
Unigene128.000.000.000.000.000.470.000.000.00
Unigene133.292.841.509.922.720.110.470.4124.2512
Unigene142.330.120.380.000.440.110.060.000.00
Unigene152.370.000.440.000.860.220.000.000.00
Unigene162.460.040.290.000.970.210.000.000.00
Unigene172.210.020.280.000.550.110.000.000.00
Unigene183.580.000.810.000.000.320.030.000.06
Unigene193.160.000.580.000.000.370.000.000.00
Unigene202.700.100.360.000.000.190.000.140.04
Unigene2110.40710.000.000.000.000.370.000.060.00
Unigene223.280.000.770.000.000.000.000.000.00
Unigene231.190.000.000.000.000.000.000.000.00
Unigene241.700.000.000.100.000.060.000.000.00
Unigene252.260.000.000.000.000.000.000.000.00
Unigene263.150.000.000.0017.39460.000.000.000.00
Unigene272.880.000.000.0017.97530.130.000.000.00
Unigene282.380.000.000.0019.80540.000.000.000.00
Unigene292.740.000.060.0019.87610.110.000.000.00
Unigene302.910.490.000.000.000.000.000.000.00
Unigene319.360.000.000.000.000.420.000.000.00
Unigene323.240.000.000.000.000.000.000.000.00
Unigene331.510.000.000.000.000.000.002.950.00
Unigene341.470.000.000.000.000.040.004.620.00
Unigene351.640.000.000.000.000.190.004.660.00
Unigene361.990.020.060.030.000.110.000.000.02
Unigene372.740.000.000.000.000.000.000.000.00
Unigene382.000.000.000.000.000.000.040.000.00
Unigene392.310.000.000.000.000.000.000.000.00
Unigene406.980.000.000.000.000.520.060.000.00
Unigene412.080.000.080.000.000.000.000.000.00
Unigene422.380.040.160.000.220.130.020.000.00
Unigene432.350.120.250.000.590.340.030.110.00
Unigene442.400.280.670.050.890.350.000.000.00
Unigene452.040.200.100.000.710.180.000.000.00
Unigene462.230.000.000.070.000.610.000.040.00
Unigene473.400.000.140.000.001.300.040.000.00
Unigene484.000.070.150.020.030.720.010.000.00
Unigene493.280.000.000.000.000.600.000.000.00
Unigene501.260.060.130.000.600.170.000.000.00
Unigene518.120.000.000.000.040.240.000.000.00
Unigene521.710.050.220.000.380.100.000.000.00
Unigene531.150.000.060.000.320.100.020.020.00
Unigene541.910.150.160.000.320.040.000.000.02
Unigene551.980.670.260.002.811.401.630.000.38
Unigene562.600.920.270.000.001.390.040.000.00
Unigene577.830.000.000.000.000.450.000.000.00
Unigene582.530.001.370.000.000.000.000.030.00
Unigene591.450.000.000.084.470.000.000.000.41
Unigene601.530.000.000.067.090.040.000.000.53
Unigene610.970.000.000.008.050.000.000.000.71
Unigene621.630.010.010.000.250.000.000.000.02
Unigene631.630.000.000.000.000.000.000.000.00
Unigene641.240.690.130.000.001.000.820.000.30
Unigene657.810.000.000.000.000.430.000.000.00
Unigene661.580.530.000.000.000.001.360.000.00
Unigene674.890.642.510.000.003.170.020.000.00
Unigene683.540.301.450.000.001.700.000.000.00
Unigene693.110.050.720.000.040.890.020.000.01
Unigene701.330.580.730.490.280.550.672.250.00
Unigene712.291.951.671.050.001.001.004.500.00
Unigene727.640.000.000.000.090.730.000.000.00
Unigene731.540.260.000.020.000.030.000.000.00
Unigene741.150.160.330.000.330.090.320.280.00
Unigene751.340.180.120.000.870.000.270.210.00
Unigene765.911.241.300.131.291.830.000.000.22
Unigene776.810.761.130.000.772.510.830.000.00
Unigene784.430.450.780.110.002.930.210.000.00
Unigene794.520.650.630.000.422.450.280.000.00
Unigene804.440.160.680.030.100.5210.68040.040.00
Unigene814.141.700.920.091.143.200.990.000.15
Unigene824.580.310.650.000.002.000.120.000.07
Unigene833.680.720.480.000.162.200.370.000.16
Unigene842.310.080.470.000.181.830.070.000.00
Unigene851.590.070.170.000.150.070.020.000.00
Unigene861.240.080.060.000.060.000.000.000.00
Unigene871.120.020.140.000.210.040.000.000.00
Unigene882.810.000.520.000.000.000.000.000.00
Unigene892.170.150.330.060.230.140.050.040.03
Unigene905.990.000.910.000.000.230.000.000.00
Unigene911.800.000.390.020.000.000.000.000.00
Unigene921.800.000.440.000.000.000.000.000.03
Unigene932.010.000.000.000.000.760.001.330.00
Unigene942.440.000.000.000.000.720.021.650.00
Unigene950.860.000.000.000.000.380.000.750.00
Unigene964.040.000.140.000.000.660.000.000.00
Unigene974.260.000.250.000.060.700.000.000.00
Unigene983.390.000.130.000.000.700.000.000.00
Unigene994.270.000.000.000.000.470.000.000.00

document location: summary/4_GenePredict/4_Unigenes_abund.txt


4.4.2 Boxplot of unigene abundance



document location: summary/4_GenePredict/4_Unigenes_abund.boxplot.png


4.4.3 Density of unigene abundance



document location: summary/4_GenePredict/4_Unigenes_abund.density.png


4.4.4 Statistics of unigene CDS


ORFs NO.739705
integrity:start139358(18.84%)
integrity:end108767(14.70%)
integrity:all442333(59.80%)
integrity:none49247(6.66%)
Total Len.(Mbp)560.34
Average Len.(bp)757.52
GC percent45.88%


document location:

summary/4_GenePredict/2_Unigenes_len.png

summary/4_GenePredict/2_Unigenes_CDS_stats.xlsx


4.4.5 Dilution curve of core/pan genes


core genes = intersection of genes from different samples

pan genes = union of genes from different samples


Dilution curve of core genes:


Dilution curve of pan genes:


document location:

summary/4_GenePredict/5_core_gene.png

summary/4_GenePredict/5_pan_gene.png


4.4.6 Venn diagram of different groups


We calculated unigenes owned by all samples and shared particularlly through venn diagram.





document location: summary/4_GenePredict/6_venn_diagrams/*.png



5. Annotation of species


DIAMOND (https://github.com/bbuchfink/diamond) was utilized to blast against NR_meta database including RefSeq, PDB, SwissProt, PIR and PRF (blastp mode,evalue ≤ 1e-5). According to classification system of species in NCBI nr_meta database, final results were shown as SuperKingdom, Phyluml, Class, Order, Family, Genus and Species by Lowest Common Ancestor algorithm.


5.1 Taxonomy and abundance of unigenes


Unigene_IDCON001CON002CON003DLF001DLF002DLF003T2D001T2D002T2D003Taxonomy
Unigene18.120.000.000.000.001.260.000.110.00d__Bacteria;p__Verrucomicrobia;c__Verrucomicrobiae;o__Verrucomicrobiales;f__Akkermansiaceae;g__Akkermansia;s__Akkermansia_muciniphila
Unigene25.100.000.120.000.000.850.000.000.00d__Bacteria;p__Verrucomicrobia;c__Verrucomicrobiae;o__Verrucomicrobiales;f__Akkermansiaceae;g__Akkermansia;s__Akkermansia_muciniphila
Unigene35.970.081.120.000.000.000.000.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Rikenellaceae;g__Alistipes;s__Alistipes_indistinctus
Unigene48.370.020.000.030.020.140.030.010.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae;g__Clostridium;s__Clostridium_sp._CAG:226
Unigene51.860.000.510.000.000.000.070.040.00d__unclassified;p__unclassified;c__unclassified;o__unclassified;f__unclassified;g__unclassified;s__unclassified
Unigene61.020.000.430.000.000.000.000.000.00d__unclassified;p__unclassified;c__unclassified;o__unclassified;f__unclassified;g__unclassified;s__unclassified
Unigene74.440.010.460.000.060.120.000.010.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Rikenellaceae;g__Alistipes;s__Alistipes_indistinctus
Unigene85.680.001.300.000.000.000.000.050.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Rikenellaceae;g__Alistipes;s__Alistipes_indistinctus
Unigene95.330.071.050.000.000.070.000.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Rikenellaceae;g__Alistipes;s__Alistipes_indistinctus
Unigene103.580.000.460.000.000.210.050.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Rikenellaceae;g__Alistipes;s__Alistipes_indistinctus
Unigene112.951.770.7456.388514.80320.001.683.580.14d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_unclassified
Unigene128.000.000.000.000.000.470.000.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae;g__Clostridium;s__Clostridium_sp._CAG:226
Unigene133.292.841.509.922.720.110.470.4124.2512d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_sp._1_1_14
Unigene142.330.120.380.000.440.110.060.000.00d__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae;g__Collinsella;s__Collinsella_unclassified
Unigene152.370.000.440.000.860.220.000.000.00d__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae;g__Collinsella;s__Collinsella_unclassified
Unigene162.460.040.290.000.970.210.000.000.00d__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae;g__Collinsella;s__Collinsella_sp._4_8_47FAA
Unigene172.210.020.280.000.550.110.000.000.00d__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae;g__Collinsella;s__Collinsella_sp._CAG:166
Unigene183.580.000.810.000.000.320.030.000.06d__Bacteria;p__Actinobacteria;c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__Bifidobacterium;s__Bifidobacterium_unclassified
Unigene193.160.000.580.000.000.370.000.000.00d__Bacteria;p__Actinobacteria;c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__Bifidobacterium;s__Bifidobacterium_unclassified
Unigene202.700.100.360.000.000.190.000.140.04d__Bacteria;p__Actinobacteria;c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__Bifidobacterium;s__Bifidobacterium_pseudocatenulatum_CAG:263
Unigene2110.40710.000.000.000.000.370.000.060.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae;g__Clostridium;s__Clostridium_sp._CAG:226
Unigene223.280.000.770.000.000.000.000.000.00d__Bacteria;p__Actinobacteria;c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__Bifidobacterium;s__Bifidobacterium_kashiwanohense
Unigene231.190.000.000.000.000.000.000.000.00d__unclassified;p__unclassified;c__unclassified;o__unclassified;f__unclassified;g__unclassified;s__unclassified
Unigene241.700.000.000.100.000.060.000.000.00d__unclassified;p__unclassified;c__unclassified;o__unclassified;f__unclassified;g__unclassified;s__unclassified
Unigene252.260.000.000.000.000.000.000.000.00d__unclassified;p__unclassified;c__unclassified;o__unclassified;f__unclassified;g__unclassified;s__unclassified
Unigene263.150.000.000.0017.39460.000.000.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroidaceae_noname;s__Bacteroidaceae_bacterium_MS4
Unigene272.880.000.000.0017.97530.130.000.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroidaceae_noname;s__Bacteroidaceae_bacterium_MS4
Unigene282.380.000.000.0019.80540.000.000.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroidaceae_noname;s__Bacteroidaceae_bacterium_MS4
Unigene292.740.000.060.0019.87610.110.000.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroidaceae_noname;s__Bacteroidaceae_bacterium_MS4
Unigene302.910.490.000.000.000.000.000.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_sp._4_3_47FAA
Unigene319.360.000.000.000.000.420.000.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae;g__Clostridium;s__Clostridium_sp._CAG:226
Unigene323.240.000.000.000.000.000.000.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_dorei
Unigene331.510.000.000.000.000.000.002.950.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Eubacteriaceae;g__Eubacterium;s__Eubacterium_sp._CAG:76
Unigene341.470.000.000.000.000.040.004.620.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Eubacteriaceae;g__Eubacterium;s__Eubacterium_sp._CAG:76
Unigene351.640.000.000.000.000.190.004.660.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Eubacteriaceae;g__Eubacterium;s__Eubacterium_sp._CAG:76
Unigene361.990.020.060.030.000.110.000.000.02d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_unclassified;g__Clostridiales_unclassified;s__Clostridiales_unclassified
Unigene372.740.000.000.000.000.000.000.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Ruminiclostridium;s__[Eubacterium]_siraeum
Unigene382.000.000.000.000.000.000.040.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Ruminiclostridium;s__[Eubacterium]_siraeum
Unigene392.310.000.000.000.000.000.000.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_unclassified;g__Clostridiales_unclassified;s__Clostridiales_unclassified
Unigene406.980.000.000.000.000.520.060.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae;g__Clostridium;s__Clostridium_sp._CAG:226
Unigene412.080.000.080.000.000.000.000.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Ruminiclostridium;s__[Eubacterium]_siraeum
Unigene422.380.040.160.000.220.130.020.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidales_noname;g__Bacteroidales_noname;s__Bacteroidales_bacterium_ph8
Unigene432.350.120.250.000.590.340.030.110.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidales_noname;g__Bacteroidales_noname;s__Bacteroidales_bacterium_ph8
Unigene442.400.280.670.050.890.350.000.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidales_noname;g__Bacteroidales_noname;s__Bacteroidales_bacterium_ph8
Unigene452.040.200.100.000.710.180.000.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidales_noname;g__Bacteroidales_noname;s__Bacteroidales_bacterium_ph8
Unigene462.230.000.000.070.000.610.000.040.00d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Holdemanella;s__Holdemanella_biformis
Unigene473.400.000.140.000.001.300.040.000.00d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Holdemanella;s__Holdemanella_biformis
Unigene484.000.070.150.020.030.720.010.000.00d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Holdemanella;s__Holdemanella_biformis
Unigene493.280.000.000.000.000.600.000.000.00d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Holdemanella;s__Holdemanella_biformis
Unigene501.260.060.130.000.600.170.000.000.00d__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae;g__Collinsella;s__Collinsella_sp._CAG:166
Unigene518.120.000.000.000.040.240.000.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae;g__Clostridium;s__Clostridium_sp._CAG:226
Unigene521.710.050.220.000.380.100.000.000.00d__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae;g__Collinsella;s__Collinsella_unclassified
Unigene531.150.000.060.000.320.100.020.020.00d__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae;g__Collinsella;s__Collinsella_sp._CAG:166
Unigene541.910.150.160.000.320.040.000.000.02d__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae;g__Collinsella;s__Collinsella_sp._4_8_47FAA
Unigene551.980.670.260.002.811.401.630.000.38d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Faecalibacterium;s__Faecalibacterium_prausnitzii
Unigene562.600.920.270.000.001.390.040.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Faecalibacterium;s__Faecalibacterium_prausnitzii
Unigene577.830.000.000.000.000.450.000.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae;g__Clostridium;s__Clostridium_sp._CAG:226
Unigene582.530.001.370.000.000.000.000.030.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_fragilis
Unigene591.450.000.000.084.470.000.000.000.41d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_fragilis
Unigene601.530.000.000.067.090.040.000.000.53d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_unclassified
Unigene610.970.000.000.008.050.000.000.000.71d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_fragilis
Unigene621.630.010.010.000.250.000.000.000.02d__Bacteria;p__Proteobacteria;c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__Parasutterella;s__Parasutterella_excrementihominis
Unigene631.630.000.000.000.000.000.000.000.00d__Bacteria;p__Proteobacteria;c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__Parasutterella;s__Parasutterella_excrementihominis
Unigene641.240.690.130.000.001.000.820.000.30d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Blautia;s__Blautia_sp._KLE_1732
Unigene657.810.000.000.000.000.430.000.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae;g__Clostridium;s__Clostridium_sp._CAG:226
Unigene661.580.530.000.000.000.001.360.000.00d__unclassified;p__unclassified;c__unclassified;o__unclassified;f__unclassified;g__unclassified;s__unclassified
Unigene674.890.642.510.000.003.170.020.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Oscillospiraceae;g__Oscillibacter;s__Oscillibacter_sp._ER4
Unigene683.540.301.450.000.001.700.000.000.00d__unclassified;p__unclassified;c__unclassified;o__unclassified;f__unclassified;g__unclassified;s__unclassified
Unigene693.110.050.720.000.040.890.020.000.01d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Oscillospiraceae;g__Oscillibacter;s__Oscillibacter_sp._ER4
Unigene701.330.580.730.490.280.550.672.250.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Porphyromonadaceae;g__Parabacteroides;s__Parabacteroides_unclassified
Unigene712.291.951.671.050.001.001.004.500.00d__unclassified;p__unclassified;c__unclassified;o__unclassified;f__unclassified;g__unclassified;s__unclassified
Unigene727.640.000.000.000.090.730.000.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae;g__Clostridium;s__Clostridium_sp._CAG:226
Unigene731.540.260.000.020.000.030.000.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_sp._HPS0048
Unigene741.150.160.330.000.330.090.320.280.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_sp._HPS0048
Unigene751.340.180.120.000.870.000.270.210.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_sp._HPS0048
Unigene765.911.241.300.131.291.830.000.000.22d__Bacteria;p__Firmicutes;c__Firmicutes_noname;o__Firmicutes_noname;f__Firmicutes_noname;g__Firmicutes_noname;s__Firmicutes_bacterium_CAG:83
Unigene776.810.761.130.000.772.510.830.000.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Oscillospiraceae;g__Oscillibacter;s__Oscillibacter_sp._CAG:241
Unigene784.430.450.780.110.002.930.210.000.00d__Bacteria;p__Firmicutes;c__Firmicutes_noname;o__Firmicutes_noname;f__Firmicutes_noname;g__Firmicutes_noname;s__Firmicutes_bacterium_CAG:83
Unigene794.520.650.630.000.422.450.280.000.00d__Bacteria;p__Firmicutes;c__Firmicutes_noname;o__Firmicutes_noname;f__Firmicutes_noname;g__Firmicutes_noname;s__Firmicutes_bacterium_CAG:83
Unigene804.440.160.680.030.100.5210.68040.040.00d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Ruminococcus;s__Ruminococcus_sp._CAG:57
Unigene814.141.700.920.091.143.200.990.000.15d__Bacteria;p__Firmicutes;c__Firmicutes_noname;o__Firmicutes_noname;f__Firmicutes_noname;g__Firmicutes_noname;s__Firmicutes_bacterium_CAG:176
Unigene824.580.310.650.000.002.000.120.000.07d__Bacteria;p__Firmicutes;c__Firmicutes_noname;o__Firmicutes_noname;f__Firmicutes_noname;g__Firmicutes_noname;s__Firmicutes_bacterium_CAG:176
Unigene833.680.720.480.000.162.200.370.000.16d__Bacteria;p__Firmicutes;c__Firmicutes_noname;o__Firmicutes_noname;f__Firmicutes_noname;g__Firmicutes_noname;s__Firmicutes_bacterium_CAG:176
Unigene842.310.080.470.000.181.830.070.000.00d__Bacteria;p__Firmicutes;c__Firmicutes_noname;o__Firmicutes_noname;f__Firmicutes_noname;g__Firmicutes_noname;s__Firmicutes_bacterium_CAG:176
Unigene851.590.070.170.000.150.070.020.000.00d__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae;g__Collinsella;s__Collinsella_sp._4_8_47FAA
Unigene861.240.080.060.000.060.000.000.000.00d__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae;g__Collinsella;s__Collinsella_aerofaciens
Unigene871.120.020.140.000.210.040.000.000.00d__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae;g__Collinsella;s__Collinsella_sp._4_8_47FAA
Unigene882.810.000.520.000.000.000.000.000.00d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Catenibacterium;s__Catenibacterium_sp._CAG:290
Unigene892.170.150.330.060.230.140.050.040.03d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Catenibacterium;s__Catenibacterium_mitsuokai
Unigene905.990.000.910.000.000.230.000.000.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Rikenellaceae;g__Alistipes;s__Alistipes_indistinctus
Unigene911.800.000.390.020.000.000.000.000.00d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Catenibacterium;s__Catenibacterium_sp._CAG:290
Unigene921.800.000.440.000.000.000.000.000.03d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Catenibacterium;s__Catenibacterium_mitsuokai
Unigene932.010.000.000.000.000.760.001.330.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_stercoris
Unigene942.440.000.000.000.000.720.021.650.00d__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae;g__Bacteroides;s__Bacteroides_stercoris
Unigene950.860.000.000.000.000.380.000.750.00d__unclassified;p__unclassified;c__unclassified;o__unclassified;f__unclassified;g__unclassified;s__unclassified
Unigene964.040.000.140.000.000.660.000.000.00d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Holdemanella;s__Holdemanella_biformis
Unigene974.260.000.250.000.060.700.000.000.00d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Holdemanella;s__Holdemanella_biformis
Unigene983.390.000.130.000.000.700.000.000.00d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Holdemanella;s__Holdemanella_biformis
Unigene994.270.000.000.000.000.470.000.000.00d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Holdemanella;s__Holdemanella_biformis

document location: summary/5_TaxonomicProfiling/Unigenes_abund_taxonomy.txt


5.2 Krona analysis



document location: summary/5_TaxonomicProfiling/krona.html


5.3 Abundance analysis


5.3.1 Abundance analysis


We calculated abundance from SuperKingdom to species in each sample and took Phylum as an example.


PhylumCON001CON002CON003DLF001DLF002DLF003T2D001T2D002T2D003
p__Bacteroidetes414760.18635855.80547111.64750758.79524851.07410170.15465413.82724467.24523149.01
p__Firmicutes355851.13246482.12187447.46100911.55323426.14373590.09365696.85143405.70310832.46
p__unclassified173674.07104536.04175052.41117089.84106136.55193277.14137458.0782485.6498899.05
p__Proteobacteria20519.895185.6480774.9915326.7133488.357078.7718706.3032703.7655138.26
p__Fusobacteria252.08187.38237.512758.56580.65404.22200.5714267.138206.12
p__Bacteria_unclassified1444.012757.061421.739143.356847.531189.421765.69588.74782.86
p__Actinobacteria10641.16807.381209.26592.702075.992005.755913.36554.091591.68
p__Bacteria_noname2346.142189.374968.941377.721567.414402.533472.80649.87478.48
p__Verrucomicrobia14109.9327.55366.737.7123.083958.1514.8627.563.13
p__Viruses_noname4446.83187.34259.841309.14272.93261.58109.52134.67117.77
p__Tenericutes370.68457.41561.93229.50256.512583.95650.97563.87396.00
p__Spirochaetes420.65234.90259.86106.97263.03410.89264.1671.24256.68
p__Euryarchaeota373.54880.6479.1595.8246.98400.8638.3329.1555.69
p__Synergistetes339.46103.6268.7072.77100.06109.42155.4320.4848.10
p__Fibrobacteres7.422.0451.42154.200.569.091.8103.47
p__Cyanobacteria61.2425.0043.752.1611.8821.7240.250.031.55
p__Chloroflexi27.5720.627.1232.702.3618.2914.941.0914.43
p__Ascomycota94.302.076.830.993.8910.963.509.596.50
p__Basidiomycota64.151.190.740.320.325.77000.03
p__Thermotogae32.792.8121.580.202.000.911.273.020.27
p__Eukaryota_noname58.530.02000.070.26000
p__Glomeromycota11.740.02000.1843.701.681.340
p__Nitrospirae4.343.061.8900.842.4143.6001.53
p__Gemmatimonadetes1.52022.273.749.700.482.170.204.96
p__Planctomycetes12.574.1712.914.470.852.433.090.110.49
p__Acidobacteria4.631.911.731.4014.455.860.051.360.05
p__Chlorobi9.253.635.133.930.080.670.083.333.43
p__Poribacteria1.9127.370000.11000
p__Marinimicrobia2.262.940.100.157.174.836.2900
p__Atribacteria3.690.1307.460.246.973.4700.03
p__Deinococcus-Thermus2.502.980.410.270.223.531.184.024.43
p__Thermodesulfobacteria1.540.161.954.9000.585.510.140.04
p__Chlamydiae6.8900.0803.323.91000
p__Aquificae2.702.1400.064.872.220.640.020.03
p__Cryptomycota10.8700.06000000
p__Aminicenantes2.691.121.0200.173.40000
p__Microsporidia7.1800000.5200.690
p__Chytridiomycota6.940.020000.04000
p__Armatimonadetes2.781.720.16000.970.0300
p__Elusimicrobia0.180.250.380.0500.054.610.160
p__Cloacimonetes0.0200003.8200.740
p__Deferribacteres1.00001.770001.650
p__Parcubacteria1.4300002.82000
p__Latescibacteria000.020.020.040.0301.552.50
p__Dictyoglomi0.400.130000.111.681.610
p__Ignavibacteriae1.000.050.190.1600.551.3500
p__Crenarchaeota1.690.24000.1401.0300
p__Chrysiogenetes02.36000.050000
p__Thaumarchaeota00.070.18000.130.430.201.02
p__Omnitrophica1.140.030000000
p__Acetothermia0.1700.0500.1100.6900
p__Blastocladiomycota0.6300000000
p__Lentisphaerae0.5200000000

document location: summary/5_TaxonomicProfiling/*/taxonomy_*_abund.xlsx


5.3.2 Stacked bar chart


We selected most abundanct classifications (TOP20) and have drawn stacked bar charts from SuperKingdom to species in each sample.






document location:

summary/5_TaxonomicProfiling/*/taxonomy_*_stacked_bar.png

summary/5_TaxonomicProfiling/*/taxonomy_*_stacked_bar.xlsx


5.3.3 Heatmap


We selected most abundanct classifications (TOP20) and have drawn heatmaps from SuperKingdom to species in each sample.





document location:

summary/5_TaxonomicProfiling/*/taxonomy_*_heatmap.png

summary/5_TaxonomicProfiling/*/taxonomy_*_heatmap.xlsx


5.3.4 Principal Component Analysis





document location: summary/5_TaxonomicProfiling/*/PCA/PCA_Group.png


5.3.5 Cluster analysis





document location: summary/5_TaxonomicProfiling/*/taxonomy_*_cluster.png


5.4 Difference analysis


Group/sample differences of abundance were analyzed using Fisher's exact test (non biological repetitions) or Kruskal-Wallis test (biological repetitions and more than two groups). We took Phylum as an example.


PhylumDLF001DLF002DLF003CON001CON002CON003meanmean_stage1mean_controllog2FCregulationp_valueq_valuesignificance
p__Latescibacteria0.020.040.03000.020.020.030.012.48up0.050.52yes
p__Fusobacteria2758.56580.65404.22252.08187.38237.51736.731247.81225.662.47up0.050.52yes
p__Cyanobacteria2.1611.8821.7261.2425.0043.7527.6311.9243.33-1.86down0.050.52yes
p__Thermotogae0.202.000.9132.792.8121.5810.051.0319.06-4.20down0.050.52yes
p__Elusimicrobia0.0500.050.180.250.380.150.030.27-3.04down0.050.52yes
p__Armatimonadetes000.972.781.720.160.940.321.55-2.27down0.120.56no
p__Cryptomycota00010.8700.061.8203.64-Infdown0.120.56no
p__Omnitrophica0001.140.0300.2000.39-Infdown0.120.56no
p__Nitrospirae00.842.414.343.061.892.091.083.10-1.51down0.130.56no
p__Planctomycetes4.470.852.4312.574.1712.916.232.589.88-1.94down0.130.56no
p__Chlorobi3.930.080.679.253.635.133.781.566.00-1.95down0.130.56no
p__Atribacteria7.460.246.973.690.1303.084.891.271.94up0.130.56no
p__Poribacteria000.111.9127.3704.900.049.76-8.02down0.250.77no
p__Dictyoglomi000.110.400.1300.110.040.18-2.30down0.250.77no
p__Crenarchaeota00.1401.690.2400.340.050.64-3.76down0.250.77no
p__Bacteria_noname1377.721567.414402.532346.142189.374968.942808.682449.223168.15-0.37down0.280.77no
p__Verrucomicrobia7.7123.083958.1514109.9327.55366.733082.191329.654834.73-1.86down0.280.77no
p__Basidiomycota0.320.325.7764.151.190.7412.082.1422.03-3.37down0.280.77no
p__Marinimicrobia0.157.174.832.262.940.102.914.051.771.20up0.280.77no
p__Blastocladiomycota0000.63000.1100.21-Infdown0.320.80no
p__Lentisphaerae0000.52000.0900.17-Infdown0.320.80no
p__Chytridiomycota000.046.940.0201.170.012.32-7.40down0.490.80no
p__Thaumarchaeota000.1300.070.180.060.040.08-0.94down0.490.80no
p__Acetothermia00.1100.1700.050.050.040.07-1.05down0.490.80no
p__Bacteria_unclassified9143.356847.531189.421444.012757.061421.733800.525726.771874.271.61up0.510.80no
p__Viruses_noname1309.14272.93261.584446.83187.34259.841122.94614.551631.34-1.41down0.510.80no
p__Tenericutes229.50256.512583.95370.68457.41561.93743.331023.32463.341.14up0.510.80no
p__Euryarchaeota95.8246.98400.86373.54880.6479.15312.83181.22444.45-1.29down0.510.80no
p__Ascomycota0.993.8910.9694.302.076.8319.845.2834.40-2.70down0.510.80no
p__Acidobacteria1.4014.455.864.631.911.735.007.232.761.39up0.510.80no
p__Deinococcus-Thermus0.270.223.532.502.980.411.651.341.96-0.55down0.510.80no
p__Aquificae0.064.872.222.702.1402.002.381.610.56up0.510.80no
p__Aminicenantes00.173.402.691.121.021.401.191.61-0.44down0.510.80no
p__Ignavibacteriae0.1600.551.000.050.190.330.240.42-0.81down0.510.80no
p__Glomeromycota00.1843.7011.740.0209.2714.633.921.90up0.660.86no
p__Microsporidia000.527.18001.280.172.39-3.79down0.800.86no
p__Cloacimonetes003.820.02000.641.270.017.47up0.800.86no
p__Deferribacteres1.77001.00000.460.590.330.82up0.800.86no
p__Parcubacteria002.821.43000.710.940.480.98up0.800.86no
p__Chrysiogenetes00.05002.3600.400.020.79-5.64down0.800.86no
p__Bacteroidetes750758.79524851.07410170.15414760.18635855.80547111.64547251.27561926.67532575.870.08up0.830.86no
p__Firmicutes100911.55323426.14373590.09355851.13246482.12187447.46264618.08265975.93263260.240.01up0.830.86no
p__unclassified117089.84106136.55193277.14173674.07104536.04175052.41144961.01138834.51151087.51-0.12down0.830.86no
p__Proteobacteria15326.7133488.357078.7720519.895185.6480774.9927062.4018631.2835493.51-0.93down0.830.86no
p__Actinobacteria592.702075.992005.7510641.16807.381209.262888.711558.154219.27-1.44down0.830.86no
p__Spirochaetes106.97263.03410.89420.65234.90259.86282.72260.30305.14-0.23down0.830.86no
p__Synergistetes72.77100.06109.42339.46103.6268.70132.3494.09170.59-0.86down0.830.86no
p__Fibrobacteres154.200.569.097.422.0451.4237.4554.6220.291.43up0.830.86no
p__Chloroflexi32.702.3618.2927.5720.627.1218.1117.7818.44-0.05down0.830.86no
p__Gemmatimonadetes3.749.700.481.52022.276.284.647.93-0.77down0.830.86no
p__Thermodesulfobacteria4.9000.581.540.161.951.521.831.220.59up0.830.86no
p__Eukaryota_noname00.070.2658.530.0209.810.1119.52-7.47down11no
p__Chlamydiae03.323.916.8900.082.372.412.320.05up11no

document location: summary/5_TaxonomicProfiling/*/diff_abundance/*vs*/*vs*.diff.xlsx


PCA:


Heatmap:


document location:

summary/5_TaxonomicProfiling/*/diff_abundance/*vs*/*vs*.PCA.png

summary/5_TaxonomicProfiling/*/diff_abundance/*vs*/*vs*.heatmap.png



6. Functional annotation


6.1 GO database


6.1.1 GO annotation of unigene


Gene ontology (GO) (http://www.geneontology.org) is a major bioinformatics initiative to unify the representation of gene and gene product attributes across all species. More specifically, the project aims to: 1) maintain and develop its controlled vocabulary of gene and gene product attributes; 2) annotate genes and gene products, and assimilate and disseminate annotation data; and 3) provide tools for easy access to all aspects of the data provided by the project, and to enable functional interpretation of experimental data using the GO, for example via enrichment analysis.

GO is part of a larger classification effort, the Open Biomedical Ontologies (OBO).

Although gene nomenclature itself aims to maintain and develop controlled vocabulary of gene and gene products, the Gene Ontology extends the effort by using markup language to make the data (not only of the genes and their products but also of all their attributes) machine readable, and to do so in a way that is unified across all species (whereas gene nomenclature conventions vary by biologic taxon).


QueryGO_hitGeneSymbolGO_IDGO_TermGO_FunctionGO_Level
Unigene3UNIPROTKB|Q882J11184288galMGO:0004034aldose 1-epimerase activitymolecular_function7
Unigene4UNIPROTKB|A5I5W55184562xdhACGO:0004854xanthine dehydrogenase activitymolecular_function7
Unigene4UNIPROTKB|A5I5W55184562xdhACGO:0005829cytosolcellular_component9
Unigene4UNIPROTKB|A5I5W55184562xdhACGO:0009115xanthine catabolic processbiological_process11
Unigene4UNIPROTKB|A5I5W55184562xdhACGO:0016903oxidoreductase activity, acting on the aldehyde or oxo group of donorsmolecular_function5
Unigene4UNIPROTKB|A5I5W55184562xdhACGO:0050660flavin adenine dinucleotide bindingmolecular_function6
Unigene10UNIPROTKB|Q8A3821074372BT_3073GO:0005829cytosolcellular_component9
Unigene10UNIPROTKB|Q8A3821074372BT_3073GO:0017150tRNA dihydrouridine synthase activitymolecular_function6
Unigene12UNIPROTKB|C4M5C63406093EHI_121800GO:0004139deoxyribose-phosphate aldolase activitymolecular_function7
Unigene12UNIPROTKB|C4M5C63406093EHI_121800GO:0009264deoxyribonucleotide catabolic processbiological_process10
Unigene12UNIPROTKB|C4M5C63406093EHI_121800GO:0016052carbohydrate catabolic processbiological_process6
Unigene13UNIPROTKB|Q8A9C11073293ligAGO:0003911DNA ligase (NAD+) activitymolecular_function7
Unigene13UNIPROTKB|Q8A9C11073293ligAGO:0005829cytosolcellular_component9
Unigene13UNIPROTKB|Q8A9C11073293ligAGO:0006288base-excision repair, DNA ligationbiological_process11
Unigene14TIGR_CMR|BA_55471085230BA_5547GO:0015986ATP synthesis coupled proton transportbiological_process12
Unigene14TIGR_CMR|BA_55471085230BA_5547GO:0045262plasma membrane proton-transporting ATP synthase complex, catalytic core F(1)cellular_component9
Unigene14TIGR_CMR|BA_55471085230BA_5547GO:0046933proton-transporting ATP synthase activity, rotational mechanismmolecular_function15
Unigene16UNIPROTKB|Q3A949-murA2GO:0008760UDP-N-acetylglucosamine 1-carboxyvinyltransferase activitymolecular_function6
Unigene16UNIPROTKB|Q3A949-murA2GO:0009252peptidoglycan biosynthetic processbiological_process9
Unigene17UNIPROTKB|Q81X17-GBAA_5432GO:0006355regulation of transcription, DNA-templatedbiological_process11
Unigene18TAIR|locus:2049435818204URH1GO:0005737cytoplasmcellular_component7
Unigene18TAIR|locus:2049435818204URH1GO:0005829cytosolcellular_component9
Unigene18TAIR|locus:2049435818204URH1GO:0006152purine nucleoside catabolic processbiological_process9
Unigene18TAIR|locus:2049435818204URH1GO:0006218uridine catabolic processbiological_process11
Unigene18TAIR|locus:2049435818204URH1GO:0016787hydrolase activitymolecular_function4
Unigene18TAIR|locus:2049435818204URH1GO:0045437uridine nucleosidase activitymolecular_function8
Unigene18TAIR|locus:2049435818204URH1GO:0047622adenosine nucleosidase activitymolecular_function8
Unigene18TAIR|locus:2049435818204URH1GO:0047724inosine nucleosidase activitymolecular_function8
Unigene18TAIR|locus:2049435818204URH1GO:0072585xanthosine nucleotidase activitymolecular_function8
Unigene19UNIPROTKB|Q4KEX13478916rbsRGO:0003700transcription factor activity, sequence-specific DNA bindingmolecular_function4
Unigene19UNIPROTKB|Q4KEX13478916rbsRGO:0006355regulation of transcription, DNA-templatedbiological_process11
Unigene33UNIPROTKB|Q47U34-CPS_5051GO:0003674molecular_functionmolecular_function2
Unigene33UNIPROTKB|Q47U34-CPS_5051GO:0005575cellular_componentcellular_component2
Unigene33UNIPROTKB|Q47U34-CPS_5051GO:0008150biological_processbiological_process2
Unigene35UNIPROTKB|Q81JH2-jagGO:0003674molecular_functionmolecular_function2
Unigene35UNIPROTKB|Q81JH2-jagGO:0008150biological_processbiological_process2
Unigene36UNIPROTKB|A5HY625184423metKGO:0004478methionine adenosyltransferase activitymolecular_function6
Unigene36UNIPROTKB|A5HY625184423metKGO:0005829cytosolcellular_component9
Unigene37UNIPROTKB|Q48FA6-PSPPH_3793GO:0008080N-acetyltransferase activitymolecular_function8
Unigene38UNIPROTKB|A5I4M35186700trmDGO:00086852-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activitymolecular_function6
Unigene39UNIPROTKB|Q5LNF0-rimMGO:0003674molecular_functionmolecular_function2
Unigene40ASPGD|ASPL0000215682-gpdAGO:0001968fibronectin bindingmolecular_function5
Unigene40ASPGD|ASPL0000215682-gpdAGO:0003723RNA bindingmolecular_function6
Unigene40ASPGD|ASPL0000215682-gpdAGO:0004365glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activitymolecular_function7
Unigene40ASPGD|ASPL0000215682-gpdAGO:0005576extracellular regioncellular_component3
Unigene40ASPGD|ASPL0000215682-gpdAGO:0005622intracellularcellular_component5
Unigene40ASPGD|ASPL0000215682-gpdAGO:0005739mitochondrioncellular_component9
Unigene40ASPGD|ASPL0000215682-gpdAGO:0005811lipid particlecellular_component9
Unigene40ASPGD|ASPL0000215682-gpdAGO:0005829cytosolcellular_component9
Unigene40ASPGD|ASPL0000215682-gpdAGO:0005886plasma membranecellular_component5
Unigene40ASPGD|ASPL0000215682-gpdAGO:0006006glucose metabolic processbiological_process9
Unigene40ASPGD|ASPL0000215682-gpdAGO:0006915apoptotic processbiological_process7
Unigene40ASPGD|ASPL0000215682-gpdAGO:0007160cell-matrix adhesionbiological_process6
Unigene40ASPGD|ASPL0000215682-gpdAGO:0009514glyoxysomecellular_component11
Unigene40ASPGD|ASPL0000215682-gpdAGO:0009986cell surfacecellular_component5
Unigene40ASPGD|ASPL0000215682-gpdAGO:0016020membranecellular_component3
Unigene40ASPGD|ASPL0000215682-gpdAGO:0030445yeast-form cell wallcellular_component8
Unigene40ASPGD|ASPL0000215682-gpdAGO:0030446hyphal cell wallcellular_component8
Unigene40ASPGD|ASPL0000215682-gpdAGO:0032874positive regulation of stress-activated MAPK cascadebiological_process12
Unigene40ASPGD|ASPL0000215682-gpdAGO:0043236laminin bindingmolecular_function5
Unigene40ASPGD|ASPL0000215682-gpdAGO:0044406adhesion of symbiont to hostbiological_process4
Unigene40ASPGD|ASPL0000215682-gpdAGO:0044416induction by symbiont of host defense responsebiological_process10
Unigene40ASPGD|ASPL0000215682-gpdAGO:0050661NADP bindingmolecular_function6
Unigene40ASPGD|ASPL0000215682-gpdAGO:0051287NAD bindingmolecular_function6
Unigene40ASPGD|ASPL0000215682-gpdAGO:0055114oxidation-reduction processbiological_process5
Unigene40ASPGD|ASPL0000215682-gpdAGO:0070994detection of oxidative stressbiological_process6
Unigene40ASPGD|ASPL0000215682-gpdAGO:0072593reactive oxygen species metabolic processbiological_process5
Unigene40ASPGD|ASPL0000215682-gpdAGO:1902772positive regulation of phosphorelay signal transduction system involved in hydrogen peroxide mediated signaling pathwaybiological_process11
Unigene43UNIPROTKB|Q74DB32686342GSU1404GO:0008150biological_processbiological_process2
Unigene44UNIPROTKB|B0K590-Teth514_0779GO:00087108-amino-7-oxononanoate synthase activitymolecular_function7
Unigene44UNIPROTKB|B0K590-Teth514_0779GO:0008890glycine C-acetyltransferase activitymolecular_function9
Unigene44UNIPROTKB|B0K590-Teth514_0779GO:0009102biotin biosynthetic processbiological_process8
Unigene44UNIPROTKB|B0K590-Teth514_0779GO:0030170pyridoxal phosphate bindingmolecular_function6
Unigene46UNIPROTKB|B8E0R97081731serSGO:0004828serine-tRNA ligase activitymolecular_function8
Unigene46UNIPROTKB|B8E0R97081731serSGO:0005737cytoplasmcellular_component7
Unigene46UNIPROTKB|B8E0R97081731serSGO:0006434seryl-tRNA aminoacylationbiological_process13
Unigene47UNIPROTKB|Q81JC11202376tadAGO:0002100tRNA wobble adenosine to inosine editingbiological_process14
Unigene47UNIPROTKB|Q81JC11202376tadAGO:0019239deaminase activitymolecular_function4
Unigene48UNIPROTKB|P09122936899dnaXGO:0003689DNA clamp loader activitymolecular_function13
Unigene48UNIPROTKB|P09122936899dnaXGO:0005663DNA replication factor C complexcellular_component12
Unigene48UNIPROTKB|P09122936899dnaXGO:0006261DNA-dependent DNA replicationbiological_process10
Unigene49UNIPROTKB|Q81W161088835recRGO:0003674molecular_functionmolecular_function2
Unigene51UNIPROTKB|A2ECT44767503TVAG_276530GO:0004124cysteine synthase activitymolecular_function6
Unigene51UNIPROTKB|A2ECT44767503TVAG_276530GO:0005737cytoplasmcellular_component7
Unigene51UNIPROTKB|A2ECT44767503TVAG_276530GO:0006535cysteine biosynthetic process from serinebiological_process10
Unigene51UNIPROTKB|A2ECT44767503TVAG_276530GO:0030170pyridoxal phosphate bindingmolecular_function6
Unigene53UNIPROTKB|A0A0H2UR62-scrKGO:0005515protein bindingmolecular_function4
Unigene54TAIR|locus:2204660844103AT1G77670GO:0005737cytoplasmcellular_component7
Unigene54TAIR|locus:2204660844103AT1G77670GO:0008483transaminase activitymolecular_function6
Unigene54TAIR|locus:2204660844103AT1G77670GO:0009058biosynthetic processbiological_process4
Unigene54TAIR|locus:2204660844103AT1G77670GO:0009507chloroplastcellular_component10
Unigene54TAIR|locus:2204660844103AT1G77670GO:0030170pyridoxal phosphate bindingmolecular_function6
Unigene57UNIPROTKB|Q3AEN9-CHY_0537GO:0003674molecular_functionmolecular_function2
Unigene57UNIPROTKB|Q3AEN9-CHY_0537GO:0008150biological_processbiological_process2
Unigene58UNIPROTKB|P72802-mom72GO:0030288outer membrane-bounded periplasmic spacecellular_component7
Unigene64UNIPROTKB|Q93JF01101419SCO5977GO:0005887integral component of plasma membranecellular_component7
Unigene64UNIPROTKB|Q93JF01101419SCO5977GO:0015179L-amino acid transmembrane transporter activitymolecular_function9
Unigene64UNIPROTKB|Q93JF01101419SCO5977GO:0015297antiporter activitymolecular_function7
Unigene67UNIPROTKB|A5HZ425184752CBO0497GO:0005215transporter activitymolecular_function3

document location: summary/6_FunctionalProfiling/GO/Unigenes_GO.txt


6.1.2 Stacked bar of GO functions/IDs





document location: summary/6_FunctionalProfiling/GO/*/GO_*_stacked_bar.png


6.1.3 Heatmap of GO functions/IDs





document location: summary/6_FunctionalProfiling/GO/*/GO_*heatmap.png


6.1.4 PCA analysis





document location: summary/6_FunctionalProfiling/GO/*/PCA/PCA_Group.png


6.1.5 Cluster analysis of GO functions/IDs





document location: summary/6_FunctionalProfiling/GO/*/GO_*_cluster.png


6.2 KEGG database


6.2.1 KEGG annotation of unigene


KEGG (Kyoto Encyclopedia of Genes and Genomes) (http://www.kegg.jp/) is a collection of databases dealing with genomes, biological pathways, diseases, drugs, and chemical substances. KEGG is utilized for bioinformatics research and education, including data analysis in genomics, metagenomics, metabolomics and other omics studies, modeling and simulation in systems biology, and translational research in drug development.


QueryKEGG_hitGeneNameGeneDescriptionKOEntryKODescriptionECPathwayEntryPathwayDefinitionKEGGLevel1KEGGLevel2
Unigene3bcel:BcellWH2_00928mro_2Aldose 1-epimerase precursor K01785aldose 1-epimerase EC:5.1.3.3bcel00010Glycolysis / GluconeogenesisMetabolismCarbohydrate metabolism
Unigene3bcel:BcellWH2_00928mro_2Aldose 1-epimerase precursor K01785aldose 1-epimerase EC:5.1.3.3bcel00052Galactose metabolismMetabolismCarbohydrate metabolism
Unigene4mta:Moth_1999-xanthine dehydrogenaseK00087xanthine dehydrogenase molybdenum-binding subunit EC:1.17.1.4mta00230Purine metabolismMetabolismNucleotide metabolism
Unigene7pep:AQ505_04660-cell division proteinK03587cell division protein FtsI (penicillin-binding protein 3)-pep00550Peptidoglycan biosynthesisMetabolismGlycan biosynthesis and metabolism
Unigene7pep:AQ505_04660-cell division proteinK03587cell division protein FtsI (penicillin-binding protein 3)-pep01501beta-Lactam resistanceHuman DiseasesDrug resistance
Unigene11acm:AciX9_0202-TonB family proteinK01182oligo-1,6-glucosidase EC:3.2.1.10acm00052Galactose metabolismMetabolismCarbohydrate metabolism
Unigene11acm:AciX9_0202-TonB family proteinK01182oligo-1,6-glucosidase EC:3.2.1.10acm00500Starch and sucrose metabolismMetabolismCarbohydrate metabolism
Unigene12ehi:EHI_121800147.t00009deoxyribose-phosphate aldolaseK01619deoxyribose-phosphate aldolase EC:4.1.2.4ehi00030Pentose phosphate pathwayMetabolismCarbohydrate metabolism
Unigene13bth:BT_0894-DNA ligaseK01972DNA ligase (NAD+) EC:6.5.1.2bth03030DNA replicationGenetic Information ProcessingReplication and repair
Unigene13bth:BT_0894-DNA ligaseK01972DNA ligase (NAD+) EC:6.5.1.2bth03410Base excision repairGenetic Information ProcessingReplication and repair
Unigene13bth:BT_0894-DNA ligaseK01972DNA ligase (NAD+) EC:6.5.1.2bth03420Nucleotide excision repairGenetic Information ProcessingReplication and repair
Unigene13bth:BT_0894-DNA ligaseK01972DNA ligase (NAD+) EC:6.5.1.2bth03430Mismatch repairGenetic Information ProcessingReplication and repair
Unigene14apv:Apar_1298-ATP synthase F1K02112F-type H+-transporting ATPase subunit beta EC:3.6.3.14apv00190Oxidative phosphorylationMetabolismEnergy metabolism
Unigene15cgo:Corgl_0191-ATP synthase F1 subcomplex epsilon subunitK02114F-type H+-transporting ATPase subunit epsilon-cgo00190Oxidative phosphorylationMetabolismEnergy metabolism
Unigene16cgo:Corgl_0192-UDP-N-acetylglucosamine 1-carboxyvinyltransferase K00790UDP-N-acetylglucosamine 1-carboxyvinyltransferase EC:2.5.1.7cgo00520Amino sugar and nucleotide sugar metabolismMetabolismCarbohydrate metabolism
Unigene16cgo:Corgl_0192-UDP-N-acetylglucosamine 1-carboxyvinyltransferase K00790UDP-N-acetylglucosamine 1-carboxyvinyltransferase EC:2.5.1.7cgo00550Peptidoglycan biosynthesisMetabolismGlycan biosynthesis and metabolism
Unigene18bpsc:BBPC_1634-inosine-uridine nucleoside hydrolaseK01239purine nucleosidase EC:3.2.2.1bpsc00230Purine metabolismMetabolismNucleotide metabolism
Unigene18bpsc:BBPC_1634-inosine-uridine nucleoside hydrolaseK01239purine nucleosidase EC:3.2.2.1bpsc00760Nicotinate and nicotinamide metabolismMetabolismMetabolism of cofactors and vitamins
Unigene19csc:Csac_0443-Alanine racemase K01775alanine racemase EC:5.1.1.1csc00473D-Alanine metabolismMetabolismMetabolism of other amino acids
Unigene19csc:Csac_0443-Alanine racemase K01775alanine racemase EC:5.1.1.1csc01502Vancomycin resistanceHuman DiseasesDrug resistance
Unigene28wvi:Weevi_0259-phosphoadenosine phosphosulfate reductaseK00957sulfate adenylyltransferase subunit 2 EC:2.7.7.4wvi00920Sulfur metabolismMetabolismEnergy metabolism
Unigene28wvi:Weevi_0259-phosphoadenosine phosphosulfate reductaseK00957sulfate adenylyltransferase subunit 2 EC:2.7.7.4wvi00230Purine metabolismMetabolismNucleotide metabolism
Unigene28wvi:Weevi_0259-phosphoadenosine phosphosulfate reductaseK00957sulfate adenylyltransferase subunit 2 EC:2.7.7.4wvi00450Selenocompound metabolismMetabolismMetabolism of other amino acids
Unigene28wvi:Weevi_0259-phosphoadenosine phosphosulfate reductaseK00957sulfate adenylyltransferase subunit 2 EC:2.7.7.4wvi00261Monobactam biosynthesisMetabolismBiosynthesis of other secondary metabolites
Unigene34eel:EUBELI_02067-preprotein translocase YidC subunitK03217YidC/Oxa1 family membrane protein insertase-eel03060Protein exportGenetic Information ProcessingFolding, sorting and degradation
Unigene34eel:EUBELI_02067-preprotein translocase YidC subunitK03217YidC/Oxa1 family membrane protein insertase-eel03070Bacterial secretion systemEnvironmental Information ProcessingMembrane transport
Unigene36esu:EUS_21680-methionine adenosyltransferase K00789S-adenosylmethionine synthetase EC:2.5.1.6esu01230Biosynthesis of amino acidsMetabolismOverview
Unigene36esu:EUS_21680-methionine adenosyltransferase K00789S-adenosylmethionine synthetase EC:2.5.1.6esu00270Cysteine and methionine metabolismMetabolismAmino acid metabolism
Unigene38syd:Syncc9605_0890-tRNA (guanine-N1)-methyltransferase K00554tRNA (guanine37-N1)-methyltransferase EC:2.1.1.228syd00900Terpenoid backbone biosynthesisMetabolismMetabolism of terpenoids and polyketides
Unigene40cls:CXIVA_19530-hypothetical proteinK00134glyceraldehyde 3-phosphate dehydrogenase EC:1.2.1.12cls01200Carbon metabolismMetabolismOverview
Unigene40cls:CXIVA_19530-hypothetical proteinK00134glyceraldehyde 3-phosphate dehydrogenase EC:1.2.1.12cls01230Biosynthesis of amino acidsMetabolismOverview
Unigene40cls:CXIVA_19530-hypothetical proteinK00134glyceraldehyde 3-phosphate dehydrogenase EC:1.2.1.12cls00010Glycolysis / GluconeogenesisMetabolismCarbohydrate metabolism
Unigene41esr:ES1_03150-haloacid dehalogenase superfamilyK01091phosphoglycolate phosphatase EC:3.1.3.18esr00630Glyoxylate and dicarboxylate metabolismMetabolismCarbohydrate metabolism
Unigene43tpi:TREPR_3204-histidinol dehydrogenase (HDH) K00013histidinol dehydrogenase EC:1.1.1.23tpi01230Biosynthesis of amino acidsMetabolismOverview
Unigene43tpi:TREPR_3204-histidinol dehydrogenase (HDH) K00013histidinol dehydrogenase EC:1.1.1.23tpi00340Histidine metabolismMetabolismAmino acid metabolism
Unigene44afd:Alfi_1224-7-keto-8-aminopelargonate synthetase-like enzymeK00639glycine C-acetyltransferase EC:2.3.1.29afd00260Glycine, serine and threonine metabolismMetabolismAmino acid metabolism
Unigene46csh:Closa_2114-seryl-tRNA synthetase K01875seryl-tRNA synthetase EC:6.1.1.11csh00970Aminoacyl-tRNA biosynthesisGenetic Information ProcessingTranslation
Unigene47nma:NMA1129-putative cytosine deaminase K01485cytosine deaminase EC:3.5.4.1nma00240Pyrimidine metabolismMetabolismNucleotide metabolism
Unigene47nma:NMA1129-putative cytosine deaminase K01485cytosine deaminase EC:3.5.4.1nma00330Arginine and proline metabolismMetabolismAmino acid metabolism
Unigene48erh:ERH_0014dnaXDNA polymerase III, gamma and tau subunitsK02343DNA polymerase III subunit gamma/tau EC:2.7.7.7erh00230Purine metabolismMetabolismNucleotide metabolism
Unigene48erh:ERH_0014dnaXDNA polymerase III, gamma and tau subunitsK02343DNA polymerase III subunit gamma/tau EC:2.7.7.7erh00240Pyrimidine metabolismMetabolismNucleotide metabolism
Unigene48erh:ERH_0014dnaXDNA polymerase III, gamma and tau subunitsK02343DNA polymerase III subunit gamma/tau EC:2.7.7.7erh03030DNA replicationGenetic Information ProcessingReplication and repair
Unigene48erh:ERH_0014dnaXDNA polymerase III, gamma and tau subunitsK02343DNA polymerase III subunit gamma/tau EC:2.7.7.7erh03430Mismatch repairGenetic Information ProcessingReplication and repair
Unigene48erh:ERH_0014dnaXDNA polymerase III, gamma and tau subunitsK02343DNA polymerase III subunit gamma/tau EC:2.7.7.7erh03440Homologous recombinationGenetic Information ProcessingReplication and repair
Unigene49erh:ERH_0015recRrecombination protein RecRK06187recombination protein RecR-erh03440Homologous recombinationGenetic Information ProcessingReplication and repair
Unigene53cgo:Corgl_1567-fructokinase K00847fructokinase EC:2.7.1.4cgo00051Fructose and mannose metabolismMetabolismCarbohydrate metabolism
Unigene53cgo:Corgl_1567-fructokinase K00847fructokinase EC:2.7.1.4cgo00500Starch and sucrose metabolismMetabolismCarbohydrate metabolism
Unigene53cgo:Corgl_1567-fructokinase K00847fructokinase EC:2.7.1.4cgo00520Amino sugar and nucleotide sugar metabolismMetabolismCarbohydrate metabolism
Unigene54mxa:MXAN_3751-aminotransferaseK14267N-succinyldiaminopimelate aminotransferase EC:2.6.1.17mxa01230Biosynthesis of amino acidsMetabolismOverview
Unigene54mxa:MXAN_3751-aminotransferaseK14267N-succinyldiaminopimelate aminotransferase EC:2.6.1.17mxa00300Lysine biosynthesisMetabolismAmino acid metabolism
Unigene56bme:BMEI1212-phosphatidylglycerophosphatase b K01096phosphatidylglycerophosphatase B EC:3.1.3.27 3.1.3.81 3.1.3.4 3.6.1.27bme00564Glycerophospholipid metabolismMetabolismLipid metabolism
Unigene58tet:TTHERM_01229030-SLEI family proteinK12600superkiller protein 3-tet03018RNA degradationGenetic Information ProcessingFolding, sorting and degradation
Unigene65txy:Thexy_0859-osmosensitive K channel His kinase sensorK07646two-component system, OmpR family, sensor histidine kinase KdpD EC:2.7.13.3txy02020Two-component systemEnvironmental Information ProcessingSignal transduction
Unigene68hht:F506_18035-LysR family transcriptional regulatorK17850LysR family transcriptional regulator, regulator of gene expression of beta-lactamase-hht01501beta-Lactam resistanceHuman DiseasesDrug resistance
Unigene70dsy:DSY4238-hypothetical proteinK18231macrolide transport system ATP-binding/permease protein-dsy02010ABC transportersEnvironmental Information ProcessingMembrane transport
Unigene73boa:Bovatus_04111-Retaining alpha-galactosidase precursor K01187alpha-glucosidase EC:3.2.1.20boa00052Galactose metabolismMetabolismCarbohydrate metabolism
Unigene73boa:Bovatus_04111-Retaining alpha-galactosidase precursor K01187alpha-glucosidase EC:3.2.1.20boa00500Starch and sucrose metabolismMetabolismCarbohydrate metabolism
Unigene75bcel:BcellWH2_02474pdxBErythronate-4-phosphate dehydrogenase K03473erythronate-4-phosphate dehydrogenase EC:1.1.1.290bcel00750Vitamin B6 metabolismMetabolismMetabolism of cofactors and vitamins
Unigene76ova:OBV_09810rpsQ30S ribosomal protein S17K02961small subunit ribosomal protein S17-ova03010RibosomeGenetic Information ProcessingTranslation
Unigene77ibu:IB211_03035c-LSU ribosomal protein L14p (L23e)K02874large subunit ribosomal protein L14-ibu03010RibosomeGenetic Information ProcessingTranslation
Unigene78ova:OBV_09830rplX50S ribosomal protein L24K02895large subunit ribosomal protein L24-ova03010RibosomeGenetic Information ProcessingTranslation
Unigene79ibu:IB211_03033c-LSU ribosomal protein L5p (L11e)K02931large subunit ribosomal protein L5-ibu03010RibosomeGenetic Information ProcessingTranslation
Unigene80rus:RBI_I01731serCphosphoserine aminotransferase K00831phosphoserine aminotransferase EC:2.6.1.52rus01200Carbon metabolismMetabolismOverview
Unigene80rus:RBI_I01731serCphosphoserine aminotransferase K00831phosphoserine aminotransferase EC:2.6.1.52rus01230Biosynthesis of amino acidsMetabolismOverview
Unigene80rus:RBI_I01731serCphosphoserine aminotransferase K00831phosphoserine aminotransferase EC:2.6.1.52rus00680Methane metabolismMetabolismEnergy metabolism
Unigene80rus:RBI_I01731serCphosphoserine aminotransferase K00831phosphoserine aminotransferase EC:2.6.1.52rus00260Glycine, serine and threonine metabolismMetabolismAmino acid metabolism
Unigene80rus:RBI_I01731serCphosphoserine aminotransferase K00831phosphoserine aminotransferase EC:2.6.1.52rus00750Vitamin B6 metabolismMetabolismMetabolism of cofactors and vitamins
Unigene81ibu:IB211_03031c-SSU ribosomal protein S8p (S15Ae)K02994small subunit ribosomal protein S8-ibu03010RibosomeGenetic Information ProcessingTranslation
Unigene82ova:OBV_09870rplF50S ribosomal protein L6K02933large subunit ribosomal protein L6-ova03010RibosomeGenetic Information ProcessingTranslation
Unigene83ova:OBV_09880rplR50S ribosomal protein L18K02881large subunit ribosomal protein L18-ova03010RibosomeGenetic Information ProcessingTranslation
Unigene84ova:OBV_09890rpsE30S ribosomal protein S5K02988small subunit ribosomal protein S5-ova03010RibosomeGenetic Information ProcessingTranslation
Unigene86shi:Shel_27620-spermidine synthaseK00797spermidine synthase EC:2.5.1.16shi00270Cysteine and methionine metabolismMetabolismAmino acid metabolism
Unigene86shi:Shel_27620-spermidine synthaseK00797spermidine synthase EC:2.5.1.16shi00330Arginine and proline metabolismMetabolismAmino acid metabolism
Unigene86shi:Shel_27620-spermidine synthaseK00797spermidine synthase EC:2.5.1.16shi00410beta-Alanine metabolismMetabolismMetabolism of other amino acids
Unigene86shi:Shel_27620-spermidine synthaseK00797spermidine synthase EC:2.5.1.16shi00480Glutathione metabolismMetabolismMetabolism of other amino acids
Unigene87mmar:MODMU_1752hemNoxygen-independent coproporphyrinogen-III oxidase K02495oxygen-independent coproporphyrinogen III oxidase EC:1.3.99.22mmar00860Porphyrin and chlorophyll metabolismMetabolismMetabolism of cofactors and vitamins
Unigene89sda:GGS_0720dnaGDNA primase K02316DNA primase EC:2.7.7.-sda03030DNA replicationGenetic Information ProcessingReplication and repair
Unigene91lpz:Lp16_1532-DNA primase DnaGK02316DNA primase EC:2.7.7.-lpz03030DNA replicationGenetic Information ProcessingReplication and repair
Unigene92cck:Ccar_20040-glycyl-tRNA ligase K01880glycyl-tRNA synthetase EC:6.1.1.14cck00970Aminoacyl-tRNA biosynthesisGenetic Information ProcessingTranslation
Unigene94smo:SELMODRAFT_82177-hypothetical proteinK05290phosphatidylinositol glycan, class K EC:2.6.-.-smo00563Glycosylphosphatidylinositol(GPI)-anchor biosynthesisMetabolismGlycan biosynthesis and metabolism
Unigene96euc:EC1_01140-dihydroorotase K01465dihydroorotase EC:3.5.2.3euc00240Pyrimidine metabolismMetabolismNucleotide metabolism
Unigene97euc:EC1_01130-aspartate carbamoyltransferase K00609aspartate carbamoyltransferase catalytic subunit EC:2.1.3.2euc00240Pyrimidine metabolismMetabolismNucleotide metabolism
Unigene97euc:EC1_01130-aspartate carbamoyltransferase K00609aspartate carbamoyltransferase catalytic subunit EC:2.1.3.2euc00250Alanine, aspartate and glutamate metabolismMetabolismAmino acid metabolism
Unigene98ztr:MYCGRDRAFT_106782-hypothetical proteinK06965protein pelota-ztr03015mRNA surveillance pathwayGenetic Information ProcessingTranslation
Unigene103msd:MYSTI_05236-sensory box histidine kinase PhoR1K07636two-component system, OmpR family, phosphate regulon sensor histidine kinase PhoR EC:2.7.13.3msd02020Two-component systemEnvironmental Information ProcessingSignal transduction
Unigene108doi:FH5T_04290-oxidoreductaseK19285FMN reductase (NADPH) EC:1.5.1.38doi00740Riboflavin metabolismMetabolismMetabolism of cofactors and vitamins
Unigene111bdo:EL88_15605-beta-N-acetylhexosaminidaseK12373hexosaminidase EC:3.2.1.52bdo00520Amino sugar and nucleotide sugar metabolismMetabolismCarbohydrate metabolism
Unigene111bdo:EL88_15605-beta-N-acetylhexosaminidaseK12373hexosaminidase EC:3.2.1.52bdo00511Other glycan degradationMetabolismGlycan biosynthesis and metabolism
Unigene112hpa:HPAG1_1423-putative integral membrane protein with a TlyC-like hemolysin domain K00088IMP dehydrogenase EC:1.1.1.205hpa00230Purine metabolismMetabolismNucleotide metabolism
Unigene113sap:Sulac_3316-Phosphonate-transporting ATPase K05685macrolide transport system ATP-binding/permease protein EC:3.6.3.-sap02010ABC transportersEnvironmental Information ProcessingMembrane transport
Unigene114cbe:Cbei_0315-pyruvate formate-lyase K00656formate C-acetyltransferase EC:2.3.1.54cbe00620Pyruvate metabolismMetabolismCarbohydrate metabolism
Unigene114cbe:Cbei_0315-pyruvate formate-lyase K00656formate C-acetyltransferase EC:2.3.1.54cbe00640Propanoate metabolismMetabolismCarbohydrate metabolism
Unigene114cbe:Cbei_0315-pyruvate formate-lyase K00656formate C-acetyltransferase EC:2.3.1.54cbe00650Butanoate metabolismMetabolismCarbohydrate metabolism
Unigene118bdo:EL88_23045-glycoside hydrolase family 95K15923alpha-L-fucosidase 2 EC:3.2.1.51bdo00511Other glycan degradationMetabolismGlycan biosynthesis and metabolism
Unigene120pru:PRU_0637pyrBaspartate carbamoyltransferase K00609aspartate carbamoyltransferase catalytic subunit EC:2.1.3.2pru00240Pyrimidine metabolismMetabolismNucleotide metabolism
Unigene120pru:PRU_0637pyrBaspartate carbamoyltransferase K00609aspartate carbamoyltransferase catalytic subunit EC:2.1.3.2pru00250Alanine, aspartate and glutamate metabolismMetabolismAmino acid metabolism
Unigene121peo:AS203_06785-aspartate carbamoyltransferase regulatory subunitK00610aspartate carbamoyltransferase regulatory subunit-peo00240Pyrimidine metabolismMetabolismNucleotide metabolism
Unigene121peo:AS203_06785-aspartate carbamoyltransferase regulatory subunitK00610aspartate carbamoyltransferase regulatory subunit-peo00250Alanine, aspartate and glutamate metabolismMetabolismAmino acid metabolism
Unigene123pru:PRU_0635glyAglycine hydroxymethyltransferase K00600glycine hydroxymethyltransferase EC:2.1.2.1pru01200Carbon metabolismMetabolismOverview

Category of enriched KEGG pathways:


document location:

summary/6_FunctionalProfiling/KEGG/Unigenes_KEGG.txt

summary/6_FunctionalProfiling/KEGG/KEGG_category.png


6.2.2 Stacked bar of KEGG pathways





document location: summary/6_FunctionalProfiling/KEGG/*/KEGG_*_stacked_bar.png


6.2.3 Heatmap of KEGG pathways





document location: summary/6_FunctionalProfiling/KEGG/*/KEGG_*_heatmap.png


6.2.4 PCA analysis





document location: summary/6_FunctionalProfiling/KEGG/*/PCA/PCA_Group.png


6.2.5 Cluster analysis of KEGG pathways





document location: summary/6_FunctionalProfiling/KEGG/*/PCA/PCA_Group.png


6.2.6 Difference analysis of KEGG pathways


We took KEGG Level1 as an example for difference analysis of KEGG pathways between different samples.


KEGGLevel1DLF001DLF002DLF003CON001CON002CON003meanmean_stage1mean_controllog2FCregulationp_valueq_valuesignificance
Human Diseases18875.3121053.0921960.3722322.6324141.3623132.7621914.2520629.5923198.92-0.17down0.050.30yes
Metabolism177773.62193025.34201007.58195756.34216969.28206730.13198543.71190602.18206485.25-0.12down0.130.30no
Cellular Processes13931.1814146.6511623.8410330.4812023.5811160.5212202.7113233.8911171.530.24up0.130.30no
NA703427.34665048.37650275.96663681.05637833.61652495.23662126.93672917.22651336.630.05up0.280.39no
Organismal Systems4756.154477.215390.054671.195868.445884.735174.634874.475474.78-0.17down0.280.39no
Genetic Information Processing52325.6261868.7579105.8468391.6468170.8172038.5166983.5364433.4069533.65-0.11down0.510.60no
Environmental Information Processing58776.0274653.4667401.1067914.2269039.8662287.7066678.7266943.5266413.930.01up0.830.83no

document location: summary/6_FunctionalProfiling/KEGG/*/diff_abundance/*vs*/*vs*.diff.xlsx


Heatmap and PCA analysis of different KEGG pathways according to their functions. We took PathwayEntry as an example.


PCA:



Heatmap:



document location:

summary/6_FunctionalProfiling/KEGG/3_PathwayEntry/diff_abundance/*vs*/*vs*.PCA.png

summary/6_FunctionalProfiling/KEGG/3_PathwayEntry/diff_abundance/*vs*/*vs*.heatmap.png


6.3 eggNOG database


6.3.1 eggNOG annotation of unigenes


The eggNOG database (http://eggnogdb.embl.de/) is a database of biological information hosted by the ensembl. It is based on the original idea of COGs (clusters of orthologous groups) and expands that idea to non-supervised orthologous groups constructed from numerous organisms. The database was created in 2007 and updated to version 4.5 in 2015. eggNOG stands for evolutionary genealogy of genes: Non-supervised Orthologous Groups.

We aligned unigenes against eggNOG database by DIAMOND (blastp mode, evalue ≤ 1e-5). Hits of highest score were annotated on unigenes with several level of eggNOG.


QueryeggNOG_hitNOGCOGFunctionalCategoryCOGFunctionalCategoryDescriptionNOGDescription
Unigene1349741.Amuc_1293NANANANA
Unigene2349741.Amuc_1421COG0515TSignal transduction mechanisms Serine Threonine protein kinase
Unigene3471870.BACINT_02778COG2017GCarbohydrate transport and metabolism converts alpha-aldose to the beta-anomer. It is active on D-glucose, L-arabinose, D-xylose, D-galactose, maltose and lactose (By similarity)
Unigene4693746.OBV_17230COG1529CEnergy production and conversion Aldehyde oxidase and xanthine dehydrogenase, molybdopterin binding
Unigene4693746.OBV_17230COG2080CEnergy production and conversion (2Fe-2S)-binding domain protein
Unigene6697281.Mahau_0023ENOG410ZHQ3SFunction unknown nhl repeat containing protein
Unigene7743722.Sph21_0061COG0768MCell wall/membrane/envelope biogenesis penicillin-binding protein
Unigene8694427.Palpr_1505ENOG411265DSFunction unknown NA
Unigene9457424.BFAG_01295NANANANA
Unigene10445970.ALIPUT_00331COG0042JTranslation, ribosomal structure and biogenesis Catalyzes the synthesis of dihydrouridine a modified base found in the D-loop of most tRNAs (By similarity)
Unigene11411476.BACOVA_03485NANANANA
Unigene125759.rna_EHI_121800-1COG0274FNucleotide transport and metabolism Catalyzes a reversible aldol reaction between acetaldehyde and D-glyceraldehyde 3-phosphate to generate 2-deoxy- D-ribose 5-phosphate (By similarity)
Unigene13469585.HMPREF9007_02350NANANANA
Unigene14411903.COLAER_01791COG0055CEnergy production and conversion Produces ATP from ADP in the presence of a proton gradient across the membrane. The catalytic sites are hosted primarily by the beta subunits (By similarity)
Unigene15411903.COLAER_01792ENOG410ZRQBSFunction unknown Produces ATP from ADP in the presence of a proton gradient across the membrane (By similarity)
Unigene16411903.COLAER_01794COG0766MCell wall/membrane/envelope biogenesis Cell wall formation. Adds enolpyruvyl to UDP-N- acetylglucosamine (By similarity)
Unigene17411903.COLAER_01796COG1316KTranscription transcriptional
Unigene18547043.BIFPSEUDO_04159COG1957FNucleotide transport and metabolism nucleoside hydrolase
Unigene19547043.BIFPSEUDO_04158COG1609KTranscription Transcriptional regulator
Unigene20547043.BIFPSEUDO_04157NANANANA
Unigene21858215.Thexy_1144ENOG410Z6EDSFunction unknown UPF0473 protein
Unigene22566552.BIFCAT_00310NANANANA
Unigene23658655.HMPREF0988_00903NANANANA
Unigene24657317.ERE_34750NANANANA
Unigene26411470.RUMGNA_02210ENOG4111XM2SFunction unknown NA
Unigene27693978.Riean_1948NANANANA
Unigene28469591.HMPREF9008_00685NANANANA
Unigene29469591.HMPREF9008_00686NANANANA
Unigene30702446.CUU_1282NANANANA
Unigene32457394.BSFG_03227NANANANA
Unigene33515620.EUBELI_02068COG0759SFunction unknown Could be involved in insertion of integral membrane proteins into the membrane (By similarity)
Unigene34515620.EUBELI_02067COG0706UIntracellular trafficking, secretion, and vesicular transport Required for the insertion and or proper folding and or complex formation of integral membrane proteins into the membrane. Involved in integration of membrane proteins that insert both dependently and independently of the Sec translocase complex, as well as at least some lipoproteins
Unigene35515620.EUBELI_02066COG1847SFunction unknown Single-stranded nucleic acid binding R3H domain-containing protein
Unigene36428128.EUBSIR_00714NANANANA
Unigene37428128.EUBSIR_00713NANANANA
Unigene38428128.EUBSIR_00712NANANANA
Unigene39657319.EUS_01900COG0806JTranslation, ribosomal structure and biogenesis An accessory protein needed during the final step in the assembly of 30S ribosomal subunit, possibly for assembly of the head region. Probably interacts with S19. Essential for efficient processing of 16S rRNA. May be needed both before and after RbfA during the maturation of 16S rRNA. It has affinity for free ribosomal 30S subunits but not for 70S ribosomes (By similarity)
Unigene40693746.OBV_02440COG0057GCarbohydrate transport and metabolism glyceraldehyde3phosphate dehydrogenase
Unigene41717961.ES1_03150NANANANA
Unigene42665954.HMPREF1017_04889NANANANA
Unigene43717959.AL1_10600COG0731CEnergy production and conversion radical SAM domain protein
Unigene44445970.ALIPUT_02369COG0156HCoenzyme transport and metabolism 8-Amino-7-oxononanoate synthase
Unigene46518637.EUBIFOR_01899COG0172JTranslation, ribosomal structure and biogenesis Catalyzes the attachment of serine to tRNA(Ser). Is also able to aminoacylate tRNA(Sec) with serine, to form the misacylated tRNA L-seryl-tRNA(Sec), which will be further converted into selenocysteinyl-tRNA(Sec) (By similarity)
Unigene47518637.EUBIFOR_01897COG0590FNucleotide transport and metabolism deaminase
Unigene47518637.EUBIFOR_01897COG0590JTranslation, ribosomal structure and biogenesis deaminase
Unigene48518637.EUBIFOR_01896COG2812LReplication, recombination and repair dna polymerase iii subunits gamma and tau
Unigene49518637.EUBIFOR_01895COG0353LReplication, recombination and repair May play a role in DNA repair. It seems to be involved in an RecBC-independent recombinational process of DNA repair. It may act with RecF and RecO (By similarity)
Unigene50411903.COLAER_01556ENOG410Z470SFunction unknown NA
Unigene51693746.OBV_28290COG0031EAmino acid transport and metabolism cysteine biosynthetic process from serine
Unigene52411903.COLAER_01557ENOG410XV9QSFunction unknown vanz family
Unigene53411903.COLAER_01558COG1940GCarbohydrate transport and metabolism ROK family
Unigene54411903.COLAER_01559COG0436EAmino acid transport and metabolism aminotransferase
Unigene55411483.FAEPRAA2165_02933ENOG4111THTSFunction unknown Protein of unknown function (DUF1643)
Unigene56411485.FAEPRAM212_03179NANANANA
Unigene57428125.CLOLEP_00061COG0628SFunction unknown Membrane
Unigene58533240.CRC_02125COG0457SFunction unknown repeat-containing protein
Unigene59457392.BSHG_03872NANANANA
Unigene60457392.BSHG_03871NANANANA
Unigene61665938.HMPREF1018_02057NANANANA
Unigene62762966.HMPREF9439_02624NANANANA
Unigene63762966.HMPREF9439_02625NANANANA
Unigene64657323.CK1_28790COG0531EAmino acid transport and metabolism amino acid
Unigene65588581.Cpap_0813ENOG4111YPESFunction unknown UspA Domain-Containing Protein
Unigene66411461.DORFOR_00527COG3666LReplication, recombination and repair transposase
Unigene67478749.BRYFOR_08448COG1055PInorganic ion transport and metabolism arsenical pump membrane protein
Unigene68478749.BRYFOR_06322COG0583KTranscription Transcriptional regulator
Unigene69742740.HMPREF9474_03233ENOG410XWEMSFunction unknown NA
Unigene70411477.PARMER_04028COG0488SFunction unknown (ABC) transporter
Unigene72243231.GSU2766COG1611SFunction unknown decarboxylase
Unigene73556259.BSGG_1588NANANANA
Unigene74556259.BSGG_0988NANANANA
Unigene75471870.BACINT_01388COG0111EAmino acid transport and metabolism Dehydrogenase
Unigene76693746.OBV_09810COG0186JTranslation, ribosomal structure and biogenesis One of the primary rRNA binding proteins, it binds specifically to the 5'-end of 16S ribosomal
Unigene77693746.OBV_09820COG0093JTranslation, ribosomal structure and biogenesis Binds to 23S rRNA. Forms part of two intersubunit bridges in the 70S ribosome (By similarity)
Unigene78693746.OBV_09830COG0198JTranslation, ribosomal structure and biogenesis One of the proteins that surrounds the polypeptide exit tunnel on the outside of the subunit (By similarity)
Unigene79411467.BACCAP_02887COG0094JTranslation, ribosomal structure and biogenesis This is 1 of the proteins that binds and probably mediates the attachment of the 5S RNA into the large ribosomal subunit, where it forms part of the central protuberance. In the 70S ribosome it contacts protein S13 of the 30S subunit (bridge B1b), connecting the 2 subunits
Unigene80428128.EUBSIR_01022NANANANA
Unigene81552398.HMPREF0866_02862COG0096JTranslation, ribosomal structure and biogenesis One of the primary rRNA binding proteins, it binds directly to 16S rRNA central domain where it helps coordinate assembly of the platform of the 30S subunit (By similarity)
Unigene82693746.OBV_09870COG0097JTranslation, ribosomal structure and biogenesis This protein binds to the 23S rRNA, and is important in its secondary structure. It is located near the subunit interface in the base of the L7 L12 stalk, and near the tRNA binding site of the peptidyltransferase center (By similarity)
Unigene83693746.OBV_09880COG0256JTranslation, ribosomal structure and biogenesis This is one of the proteins that binds and probably mediates the attachment of the 5S RNA into the large ribosomal subunit, where it forms part of the central protuberance (By similarity)
Unigene84693746.OBV_09890COG0098JTranslation, ribosomal structure and biogenesis Located at the back of the 30S subunit body where it stabilizes the conformation of the head with respect to the body (By similarity)
Unigene85411903.COLAER_00540COG1201LReplication, recombination and repair purine NTP-dependent helicase activity
Unigene86411903.COLAER_00542ENOG410ZXB1SFunction unknown synthase
Unigene87411903.COLAER_00543COG1243BChromatin structure and dynamics Histone acetyltransferase
Unigene87411903.COLAER_00543COG1243KTranscription Histone acetyltransferase
Unigene88469596.HMPREF9488_00703COG2384SFunction unknown sam-dependent methyltransferase
Unigene89469596.HMPREF9488_00702COG0568KTranscription Sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released (By similarity)
Unigene91469596.HMPREF9488_00701COG0358LReplication, recombination and repair DNA primase activity
Unigene92469596.HMPREF9488_00700COG0423JTranslation, ribosomal structure and biogenesis Catalyzes the attachment of glycine to tRNA(Gly) (By similarity)
Unigene93563193.HMPREF0619_02128NANANANA
Unigene94563193.HMPREF0619_02129NANANANA
Unigene96518637.EUBIFOR_02326COG0044FNucleotide transport and metabolism Dihydroorotase
Unigene97518637.EUBIFOR_02327COG0540FNucleotide transport and metabolism aspartate transcarbamylase
Unigene98518637.EUBIFOR_02328COG0251JTranslation, ribosomal structure and biogenesis Endoribonuclease LPSP
Unigene99518637.EUBIFOR_02329ENOG410YZ7DSFunction unknown NA
Unigene100246199.CUS_5227NANANANA
Unigene101518637.EUBIFOR_02487NANANANA
Unigene102641112.RflaF_010100000125ENOG410XPE8VDefense mechanisms Efflux ABC transporter, permease protein
Unigene103637887.Clo1313_1699NANANANA

document location: summary/6_FunctionalProfiling/eggNOG/Unigenes_eggNOG.txt


Number of unigenes on category of eggNOG:

document location: summary/6_FunctionalProfiling/eggNOG/eggNOG_category.png


Taxonomy counts of eggNOG:

aciNOG96
acidNOG41
acoNOG46
actNOG6082
agaNOG10
agarNOG10
apiNOG68
aproNOG736
aquNOG104
arNOG1395
arcNOG14
artNOG79
arthNOG2
ascNOG151
aveNOG3
bacNOG6934
bactNOG446655
bacteNOG75920
basNOG23
bctoNOG95958
biNOG281
bproNOG5225
braNOG17
carNOG6
chaNOG4
chlNOG81
chlaNOG16
chloNOG220
chlorNOG60
chloroNOG22
chorNOG139
chrNOG24
cloNOG238019
cocNOG15
creNOG41
cryNOG10
cyaNOG312
cytNOG638
debNOG4
defNOG48
dehNOG17
deiNOG87
delNOG7243
dipNOG19
dotNOG9
dproNOG6863
droNOG16
eproNOG175
eryNOG16373
euNOG1276
eurNOG920
euroNOG27
eurotNOG15
fiNOG43
firmNOG291531
flaNOG3013
fuNOG178
fusoNOG4762
gproNOG6170
haeNOG46
halNOG52
homNOG5
hymNOG6
hypNOG20
inNOG63
kinNOG13
lepNOG10
lilNOG23
maNOG60
magNOG6
meNOG323
metNOG353
methNOG29
methaNOG204
necNOG11
negNOG17576
nemNOG26
onyNOG10
opiNOG528
perNOG65
plaNOG89
pleNOG7
poaNOG19
prNOG14
proNOG20931
rhaNOG22
roNOG14
sacNOG29
saccNOG48
sorNOG11
sordNOG41
sphNOG786
spiNOG1485
spriNOG29
strNOG94
synNOG428
tenNOG114
thaNOG6
theNOG2
therNOG274
thermNOG16
treNOG5
veNOG123
verNOG1700
verrNOG1471
virNOG120

document location: summary/6_FunctionalProfiling/eggNOG/eggNOG_taxon_count.xlsx


6.3.2 Stacked bar of eggNOG


This section is similar with 6.2.2 Stacked bar of KEGG pathways

document location: summary/6_FunctionalProfiling/eggNOG/*/eggNOG_*_stacked_bar.png


6.3.3 Heatmap of eggNOG


This section is similar with 6.2.3 Heatmap of KEGG pathways

document location: summary/6_FunctionalProfiling/eggNOG/*/eggNOG_*_heatmap.png


6.3.4 PCA analysis


This section is similar with 6.2.4 PCA analysis

document location: summary/6_FunctionalProfiling/eggNOG/*/PCA/PCA_Group.png


6.3.5 Cluster analysis of eggNOG


This section is similar with 6.2.5 Cluster analysis of KEGG pathways

document location: summary/6_FunctionalProfiling/eggNOG/*/eggNOG_*_cluster.png


6.3.6 Difference analysis of eggNOG


This section is similar with 6.2.6 Difference analysis of KEGG pathways

document location:

summary/6_FunctionalProfiling/eggNOG/*/diff_abundance/*vs*/*vs*.diff.xlsx

summary/6_FunctionalProfiling/eggNOG/*/diff_abundance/*vs*/*vs*.PCA.png

summary/6_FunctionalProfiling/eggNOG/*/diff_abundance/*vs*/*vs*.heatmap.png


6.4 CAZy database


6.4.1 CAZy annotation of unigenes


CAZy (http://www.cazy.org/) is a database of Carbohydrate-Active enZYmes (CAZymes). The database contains a classification and associated information about enzymes involved in the synthesis, metabolism, and transport of carbohydrates. Included in the database are glycoside hydrolases, glycosyltransferases, polysaccharide lyases, carbohydrate esterase and carbohydrate-binding families.

CAZy was established in 1999 in order to provide online and constantly updated access to the family classification of CAZymes. New genomes are added shortly after they appear in the daily releases of GenBank. As of November 2013, CAZy contains sequence information on nearly 340,000 CAZymes.

The CAZy database is coupled with the CAZypedia online encyclopedia, which was launched in June 2009 and intended to be a wiki-based encyclopedia of CAZymes. As of 2014, CAZy is developed by the Glycogenomics group at AFMB, a research centre affiliated with the French National Centre for Scientific Research and Aix-Marseille University.

We aligned unigenes against CAZy database by DIAMOND (blastp mode, evalue ≤ 1e-5). Hits of highest score were annotated on unigenes.


QueryCAZy_hitNCBIAnnoECCAZyLevel1CAZyLevel2
Unigene3AEA20065.1aldose 1-epimerase [Prevotella denticola F0289] NAGlycoside HydrolasesGH43
Unigene7AJQ27844.1penicillin-binding protein, 1A family [Pelosinus fermentans JBW45] NAGlycosylTransferasesGT51
Unigene11ADW67276.1TonB family protein [Granulicella tundricola MP5ACTX9] NAGlycoside HydrolasesGH13
Unigene47ALU14107.1glycoside hydrolase GH13 family [Eubacterium limosum] NAGlycoside HydrolasesGH13
Unigene58AMN56057.1hypothetical protein ACP90_18880 [Labrenzia sp. CP4] NAGlycoside HydrolasesGH23
Unigene70AJA56769.1teichoic acid ABC transporter ATP-binding protein [Lactococcus lactis subsp. lactis] NACarbohydrate-Binding ModulesCBM50
Unigene73ALJ48706.1Retaining alpha-galactosidase precursor [Bacteroides ovatus] NAGlycoside HydrolasesGH97
Unigene96AKP41985.1N-acetylglucosamine-6-phosphate deacetylase [Peptoclostridium difficile ATCC 9689 = DSM 1296] NACarbohydrate EsterasesCE9
Unigene111AII64493.1beta-N-acetylhexosaminidase [Bacteroides dorei] NAGlycoside HydrolasesGH20
Unigene118AII65850.1glycoside hydrolase family 95 [Bacteroides dorei] NAGlycoside HydrolasesGH95
Unigene119ALJ44652.1Alpha-1,3-galactosidase A [Bacteroides thetaiotaomicron] NAGlycoside HydrolasesGH110
Unigene123AHO16406.1glycogen debranching protein [Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121179] NAGlycoside HydrolasesGH13
Unigene126AGC90885.1TP901 family prophage L54a [Staphylococcus warneri SG1] NAGlycoside HydrolasesGH23
Unigene151BAA34114.1chitinase D precursor [Bacillus circulans] 3.2.1.14Carbohydrate-Binding ModulesCBM12
Unigene151BAA34114.1chitinase D precursor [Bacillus circulans] 3.2.1.14Glycoside HydrolasesGH18
Unigene153CDL13121.2virB1-like protein [Bifidobacterium bifidum] NAGlycoside HydrolasesGH23
Unigene154AMC01573.1endopeptidase LytF [Aerococcus viridans] NACarbohydrate-Binding ModulesCBM50
Unigene169AJK45936.1glycosyl transferase, family 9 [Burkholderia glumae PG1] NAGlycosylTransferasesGT9
Unigene184AEA24083.1asparagine synthase (glutamine-hydrolyzing) [Pseudonocardia dioxanivorans CB1190] NAGlycosylTransferasesGT4
Unigene211AHO10709.1ADP-heptose--LPS heptosyltransferase [Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121178] NAGlycosylTransferasesGT9
Unigene234ABN54008.1Glucan endo-1,3-beta-D-glucosidase [Ruminiclostridium thermocellum ATCC 27405] 3.2.1.73Carbohydrate-Binding ModulesCBM4
Unigene234ABN54008.1Glucan endo-1,3-beta-D-glucosidase [Ruminiclostridium thermocellum ATCC 27405] 3.2.1.73Carbohydrate-Binding ModulesCBM54
Unigene234ABN54008.1Glucan endo-1,3-beta-D-glucosidase [Ruminiclostridium thermocellum ATCC 27405] 3.2.1.73Glycoside HydrolasesGH16
Unigene236AFM24456.1membrane-bound metallopeptidase [Desulfomonile tiedjei DSM 6799] NACarbohydrate-Binding ModulesCBM50
Unigene239CBL14028.1Lyzozyme M1 (1,4-beta-N-acetylmuramidase) [Roseburia intestinalis XB6B4] NAGlycoside HydrolasesGH25
Unigene240AKA51339.1alpha-galactosidase [Bacteroides fragilis] NAGlycoside HydrolasesGH27
Unigene241ADV44736.1Beta-N-acetylhexosaminidase [Bacteroides helcogenes P 36-108] NAGlycoside HydrolasesGH20
Unigene242ADV44737.1Beta-N-acetylhexosaminidase [Bacteroides helcogenes P 36-108] NAGlycoside HydrolasesGH20
Unigene255AJA56769.1teichoic acid ABC transporter ATP-binding protein [Lactococcus lactis subsp. lactis] NACarbohydrate-Binding ModulesCBM50
Unigene257ALJ62047.13-oxoadipate enol-lactonase 2 [Bacteroides cellulosilyticus] NAGlycoside HydrolasesGH28
Unigene259ALJ62045.1Retaining alpha-galactosidase precursor [Bacteroides cellulosilyticus] NAGlycoside HydrolasesGH97
Unigene265ADV44010.1glycosyl transferase family 2 [Bacteroides helcogenes P 36-108] NAGlycosylTransferasesGT2
Unigene268AAX58523.1HrpW [Pseudomonas viridiflava] NAPolysaccharide LyasesPL3
Unigene274ACM12046.1penicillin-binding protein [Bacillus cereus Q1] NAGlycosylTransferasesGT51
Unigene279CCO05379.1Glycoside Hydrolase Family 25 protein [Ruminococcus bicirculans] NAGlycoside HydrolasesGH25
Unigene281CBL14115.1Glycosidases [Roseburia intestinalis XB6B4] NAGlycoside HydrolasesGH13
Unigene285BAS27096.1hypothetical protein LIP_1239 [Limnochorda pilosa] NACarbohydrate-Binding ModulesCBM50
Unigene324AMD89422.1ABC transporter [Desulfovibrio fairfieldensis] NAGlycosylTransferasesGT4
Unigene331EAA63395.1hypothetical protein AN2824.2 [Aspergillus nidulans FGSC A4] NAGlycoside HydrolasesGH2
Unigene337AEE54090.1glycosyl hydrolase BNR repeat-containing protein [Haliscomenobacter hydrossis DSM 1100] NAGlycoside HydrolasesGH33
Unigene343CAL53384.1DDX20_HUMAN Probable ATP-dependent RNA helicase DDX20 (ISS) [Ostreococcus tauri] NACarbohydrate EsterasesCE11
Unigene352ABO51302.1cell wall hydrolase, SleB [Desulfotomaculum reducens MI-1] NACarbohydrate-Binding ModulesCBM50
Unigene372ACL38797.1conserved hypothetical protein [Pseudarthrobacter chlorophenolicus A6] NAGlycoside HydrolasesGH23
Unigene385ACE83269.1peptidase, M23/M37 family [Cellvibrio japonicus Ueda107] NACarbohydrate-Binding ModulesCBM50
Unigene386AGH13541.1hypothetical protein [uncultured bacterium pUR16A2] 3.2.1.40Carbohydrate EsterasesCE15
Unigene386AGH13541.1hypothetical protein [uncultured bacterium pUR16A2] 3.2.1.40Glycoside HydrolasesGH78
Unigene388ABW67237.1tetraacyldisaccharide 4'-kinase [Desulfococcus oleovorans Hxd3] NAGlycosylTransferasesGT30
Unigene391ALJ61699.1Beta-galactosidase [Bacteroides cellulosilyticus] NAGlycoside HydrolasesGH2
Unigene413BAA25316.1sialyltransferase 0160 [Photobacterium damselae] 2.4.99.1GlycosylTransferasesGT80
Unigene416ALJ44681.1Retaining alpha-galactosidase precursor [Bacteroides ovatus] NAGlycoside HydrolasesGH97
Unigene418ACG78479.1UDP-galactopyranose mutase [Phenylobacterium zucineum HLK1] NAGlycosylTransferasesGT4
Unigene419ACR74792.1glycosyltransferase [[Eubacterium rectale] ATCC 33656] NAGlycosylTransferasesGT2
Unigene422AFN84566.1beta-glucosidase-related glycosidase [uncultured bacterium scaffold00090] NAGlycoside HydrolasesGH3
Unigene429AAQ58026.2conserved hypothetical protein [Chromobacterium violaceum ATCC 12472] NAGlycoside HydrolasesGH23
Unigene439AAO76290.1two-component system sensor histidine kinase/response regulator, hybrid (one component system) [Bacteroides thetaiotaomicron VPI-5482] NAGlycosylTransferasesGT2
Unigene440AAO76290.1two-component system sensor histidine kinase/response regulator, hybrid (one component system) [Bacteroides thetaiotaomicron VPI-5482] NAGlycosylTransferasesGT2
Unigene455ADL32884.1glycosyl transferase GT4 family [Butyrivibrio proteoclasticus B316] NAGlycosylTransferasesGT4
Unigene487CAD77137.1conserved hypothetical protein [Rhodopirellula baltica SH 1] NAGlycoside HydrolasesGH33
Unigene490CBL34358.1Glycosyltransferases, probably involved in cell wall biogenesis [[Eubacterium] siraeum V10Sc8a] NAGlycosylTransferasesGT2
Unigene492CAL53384.1DDX20_HUMAN Probable ATP-dependent RNA helicase DDX20 (ISS) [Ostreococcus tauri] NACarbohydrate EsterasesCE11
Unigene493BAP86358.1NlpC/P60 family peptidase [Lactobacillus hokkaidonensis JCM 18461] NAGlycoside HydrolasesGH23
Unigene500CCO05353.1b-mannanase; b-1,3-xylanase (Carbohydrate-Binding Module Family 35 protein / Glycoside Hydrolase Family 26 protein) [Ruminococcus bicirculans] NACarbohydrate-Binding ModulesCBM35
Unigene500CCO05353.1b-mannanase; b-1,3-xylanase (Carbohydrate-Binding Module Family 35 protein / Glycoside Hydrolase Family 26 protein) [Ruminococcus bicirculans] NAGlycoside HydrolasesGH26
Unigene507ALS73835.1elastin-binding protein EbpS [Planococcus rifietoensis] NACarbohydrate-Binding ModulesCBM50
Unigene516ACT97502.1glycoside hydrolase and putative multidrug/cation efflux pump [uncultured organism] NAGlycoside HydrolasesGH78
Unigene520ADK30641.1UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase [Brachyspira pilosicoli 95/1000] NACarbohydrate EsterasesCE11
Unigene522AJS57572.1hypothetical protein UB51_02700 [Paenibacillus sp. IHBB 10380] NAGlycosylTransferasesGT2
Unigene542AMD89422.1ABC transporter [Desulfovibrio fairfieldensis] NAGlycosylTransferasesGT4
Unigene545AII12421.1Teichoic acid ABC transporter [Lactococcus lactis subsp. lactis NCDO 2118] NACarbohydrate-Binding ModulesCBM50
Unigene546CBL01588.1Predicted glycosyltransferases [Faecalibacterium prausnitzii SL3/3] NAGlycosylTransferasesGT2
Unigene559CBK95964.1Cellulase (glycosyl hydrolase family 5)./Fibronectin type III domain [[Eubacterium] siraeum 70/3] NAGlycoside HydrolasesGH5
Unigene565ADU21958.1Fibronectin type III domain protein [Ruminococcus albus 7 = DSM 20455] NACarbohydrate-Binding ModulesCBM37
Unigene570CBL01670.1Glycosyltransferases involved in cell wall biogenesis [Faecalibacterium prausnitzii SL3/3] NAGlycosylTransferasesGT2
Unigene573CBL39379.1Glycosyltransferase [Anaerostipes hadrus] NAGlycosylTransferasesGT4
Unigene577ALK84497.1Putative N-acetylmannosaminyltransferase [Bacteroides vulgatus] NAGlycosylTransferasesGT26
Unigene578CEF76964.1unnamed protein product [Fusarium graminearum] NAGlycoside HydrolasesGH18
Unigene589ALJ49465.1Arabinogalactan endo-1,4-beta-galactosidase precursor [Bacteroides ovatus] NAGlycoside HydrolasesGH53
Unigene594CBK77705.1Beta-N-acetylglucosaminidase [[Clostridium] cf. saccharolyticum K10] NAGlycoside HydrolasesGH73
Unigene598CCO05341.1Polysaccharide deacetylase (Carbohydrate Esterase Family 4 protein) [Ruminococcus bicirculans] NACarbohydrate EsterasesCE4
Unigene613CCO05339.1maltodextrin phosphorylase (Glycosyltransferase Family 35 protein) [Ruminococcus bicirculans] NAGlycosylTransferasesGT35
Unigene621ADL33049.1xylosidase/arabinofuranosidase and esterase Xsa43H [Butyrivibrio proteoclasticus B316] NAGlycoside HydrolasesGH43
Unigene623CCO05338.14-alpha-glucanotransferase (Glycoside Hydrolase Family 77 protein) [Ruminococcus bicirculans] NAGlycoside HydrolasesGH77
Unigene639AEU37085.1esterase [Granulicella mallensis MP5ACTX8] NACarbohydrate EsterasesCE1
Unigene661ALJ59064.1Beta-hexosaminidase [Bacteroides cellulosilyticus] NAGlycoside HydrolasesGH20
Unigene662AMV36480.1ribonucleoside hydrolase RihC [Planctomyces sp. SH-PL62] NAGlycoside HydrolasesGH33
Unigene667EDV07336.1heparinase II/III-like protein [Bacteroides intestinalis DSM 17393] NAPolysaccharide LyasesPL21
Unigene683AAN14054.2mucin 96D [Drosophila melanogaster] NACarbohydrate-Binding ModulesCBM14
Unigene713AJY47325.1UDP-phosphate galactose phosphotransferase [Martelella endophytica] NAGlycosylTransferasesGT26
Unigene714ABR44152.1conserved hypothetical protein [Parabacteroides distasonis ATCC 8503] NAGlycoside HydrolasesGH123
Unigene731ALJ44213.1N-acetylglucosamine-6-phosphate deacetylase [Bacteroides thetaiotaomicron] NACarbohydrate EsterasesCE9
Unigene732AEL24242.1glucosamine/galactosamine-6-phosphate isomerase [Cyclobacterium marinum DSM 745] NACarbohydrate EsterasesCE9
Unigene734AAO76290.1two-component system sensor histidine kinase/response regulator, hybrid (one component system) [Bacteroides thetaiotaomicron VPI-5482] NAGlycosylTransferasesGT2
Unigene735CDS95601.1Glycosyl hydrolase family 109 protein 1 [Sphingobacterium sp. PM2-P1-29] NAGlycoside HydrolasesGH109
Unigene749BAN03325.1glycosyltransferase [Ilumatobacter coccineus YM16-304] NAGlycosylTransferasesGT2
Unigene764AJS60070.15'-nucleotidase [Paenibacillus sp. IHBB 10380] NACarbohydrate-Binding ModulesCBM50
Unigene765ALS24964.1family 65 glycosyl hydrolase [Paenibacillus naphthalenovorans] NAGlycoside HydrolasesGH65
Unigene775CBK64070.1Glycosyltransferases involved in cell wall biogenesis [Alistipes shahii WAL 8301] NAGlycosylTransferasesGT2
Unigene777AGB28845.1Glycoside hydrolase 97 [Prevotella dentalis DSM 3688] NAGlycoside HydrolasesGH97
Unigene781AAO76290.1two-component system sensor histidine kinase/response regulator, hybrid (one component system) [Bacteroides thetaiotaomicron VPI-5482] NAGlycosylTransferasesGT2

document location: summary/6_FunctionalProfiling/CAZy/Unigenes_CAZy.txt


document location: summary/6_FunctionalProfiling/CAZy/CAZy_category.png


6.4.2 Stacked bar of CAZy


This section is similar with 6.2.2 Stacked bar of KEGG pathways

document location: summary/6_FunctionalProfiling/CAZy/*/CAZy_*_stacked_bar.png


6.4.3 Heatmap of CAZy


This section is similar with 6.2.3 Heatmap of KEGG pathways

document location: summary/6_FunctionalProfiling/CAZy/*/CAZy_*_heatmap.png


6.4.4 PCA analysis


This section is similar with 6.2.4 PCA analysis

document location: summary/6_FunctionalProfiling/CAZy/*/PCA/PCA_Group.png


6.4.5 Cluster analysis of CAZy


This section is similar with 6.2.5 Cluster analysis of KEGG pathways

document location: summary/6_FunctionalProfiling/CAZy/*/CAZy_*_cluster.png


6.4.6 Difference analysis of CAZy


This section is similar with 6.2.6 Difference analysis of KEGG pathways

document location:

summary/6_FunctionalProfiling/CAZy/*/diff_abundance/*vs*/*vs*.diff.xlsx

summary/6_FunctionalProfiling/CAZy/*/diff_abundance/*vs*/*vs*.PCA.png

summary/6_FunctionalProfiling/CAZy/*/diff_abundance/*vs*/*vs*.heatmap.png


6.5 CARD database


6.5.1 CAZy annotation


The Comprehensive Antibiotic Resistance Database ("CARD") (https://card.mcmaster.ca/) provides data, models, and algorithms relating to the molecular basis of antimicrobial resistance. The CARD provides curated reference sequences and SNPs organized via the Antibiotic Resistance Ontology ("ARO"). These data can be browsed on the website or downloaded in a number of formats. These data are additionally associated with detection models, in the form of curated homology cut-offs and SNP maps, for prediction of resistome from molecular sequences. These models can be downloaded or can be used for analysis of genome sequences using the Resistance Gene Identifier ("RGI"), either online or as a stand-alone tool.

The CARD was designed and developed by the laboratories of Drs. Gerry Wright and Andrew G. McArthur of McMaster University's Department of Biochemistry & Biomedical Sciences (Hamilton, Ontario, Canada) with the help of a global team of collaborators. It is built entirely using open source software and tools. This research has been supported by funds from the Canadian Foundation for Innovation, Canadian Institutes of Health Research, Natural Sciences and Engineering Research Council of Canada, Medical Research Council (UK), and Ontario Research Fund, as well as a Cisco Research Chair in Bioinformatics supported by Cisco Systems Canada, Inc. (Dr. McArthur), Canada Research Chair (Dr. Wright), and Killam Research Fellowship (Dr. Wright).


QueryCARD_hitARO_idARO_nameARO_definition
Unigene70gi|2769708|ARO:3000118|vgaBARO:3000118vgaBVga(B) is an efflux protein expressed in staphylococci that confers resistance to streptogramin A antibiotics and related compounds. It is associated with plasmid DNA." [PMID:9427556, PMID:15728891]
Unigene75gi|7110136|ARO:3002945|vanHFARO:3002945vanHFvanHF is a vanH variant in the vanF gene cluster" [PMID:15980329]
Unigene103gi|AEX49906.1|ARO:3003583|PmrBARO:3003583PmrBHistidine protein kinase sensor Lipid A modification gene; part of a two-component system involved in polymyxin resistance that senses high extracellular Fe(2+)" [PMID:14507375, PMID:25006521]
Unigene255gi|437315|ARO:3002987|bcrAARO:3002987bcrAbcrA is an ABC transporter found in Bacillus licheniformis that confers bacitracin resistance" [PMID:7476193]
Unigene324gi|99079563|ARO:3002881|lmrCARO:3002881lmrClmrC is a chromosomally-encoded efflux pump that confers resistance to lincosamides in Streptomyces lincolnensis and Lactococcus lactis. It can dimerize with lmrD" [PMID:16958846]
Unigene381gi|27461218|ARO:3002944|vanHDARO:3002944vanHDvanHD is a vanH variant in the vanD gene cluster" [PMID:16323116, PMID:12499162]
Unigene389gi|169633158|ARO:3000777|adeFARO:3000777adeFAdeF is the membrane fusion protein of the multidrug efflux complex AdeFGH." [PMID:20696879]
Unigene390gi|152938410|ARO:3000784|cmeBARO:3000784cmeBCmeB is the inner membrane transporter the CmeABC multidrug efflux complex." [PMID:15728904]
Unigene394gi|77380194|ARO:3000575|vanUARO:3000575vanUVanU is a transcriptional activator of the vanG operon of vancomycin resistance genes." [PMID:11036060, PMID:14617152]
Unigene412gi|444896800|ARO:3000816|mtrAARO:3000816mtrAMtrA is a transcriptional activator of the MtrCDE multidrug efflux pump of Neisseria gonorrhoeae." [PMID:10417654]
Unigene414gi|57652085|ARO:3000489|sav1866ARO:3000489sav1866Sav1866 is a multidrug efflux pump in the Gram-positive Staphylococcus aureus. It is a homolog of the human ABC transporter Mdr1 and pumps out toxic compounds including verapamil, tetraphenylphosphorchloride, and Hoechst 33342." [PMID:16943773, PMID:17303126]
Unigene419gi|1788588|ARO:3003578|PmrFARO:3003578PmrFPmrF is required for the synthesis and transfer of 4-amino-4-deoxy-L-arabinose (Ara4N) to Lipid A, which allows gram-negative bacteria to resist the antimicrobial activity of cationic antimicrobial peptides and antibiotics such as polymyxin" [PMID:9570402]
Unigene431gi|15595624|ARO:3000379|oprMARO:3000379oprMOprM is an outer membrane factor protein found in Pseudomonas aeruginosa and Burkholderia vietnamiensis. It is part of the MexAB-OprM, MexVW-OprM, MexXY-OprM and the AmrAB-OprM complex." [PMID:16511029, PMID:15797729, PMID:16508113]
Unigene435gi|1150987|ARO:3002866|dfrDARO:3002866dfrDdfrD is a plasmid-encoded dihydrofolate reductase found in Listeria monocytogenes" [PMID:9145882]
Unigene436gi|4103865|ARO:3002875|dfrEARO:3002875dfrEdfrE is a chromosome-encoded dihydrofolate reductase found in Enterococcus faecalis" [PMID:9869579]
Unigene440gi|1788713|ARO:3000833|evgSARO:3000833evgSEvgS is a sensor protein that phosphorylates the regulatory protein EvgA." [PMID:11914367]
Unigene516gi|152938410|ARO:3000784|cmeBARO:3000784cmeBCmeB is the inner membrane transporter the CmeABC multidrug efflux complex." [PMID:15728904]
Unigene519gi|WP_011461302.1|ARO:3003726|vanSIARO:3003726vanSIVanSI is a vanS variant found in the vanI gene cluster; it is a histidine kinase." [PMID:16513756, PMID:19414574]
Unigene520gi|155039|ARO:3002919|vanRAARO:3002919vanRAvanRA, also known as vanR, is a vanR variant found in the vanA gene cluster" [PMID:8380148, PMID:16323116]
Unigene522gi|386372244|ARO:3002670|catARO:3002670catcat is used to describe many variants of the chloramphenicol acetyltransferase gene in a range of organisms including Acinetobacter calcoaceticus, Agrobacterium tumefaciens, Bacillus clausii, Bacillus subtilis, Campylobacter coli, Enterococcus faecalis, Enterococcus faecium, Lactococcus lactis, Listeria monocytogenes, Listonella anguillarum\nMorganella morganii, Photobacterium damselae subsp. piscicida, Proteus mirabilis, Salmonella typhi, Serratia marcescens, Shigella flexneri, Staphylococcus aureus, Staphylococcus haemolyticus, Staphylococcus intermedius, Streptococcus agalactiae, Streptococcus suis and Streptomyces acrimycini" [PMID:1461942, PMID:3860383, PMID:3865770, PMID:12726767, PMID:1929282, PMID:11677608, PMID:2013403, PMID:2697637, PMID:19459958, PMID:11735367, PMID:1406372, PMID:1517170, PMID:6950931, PMID:2993795, PMID:2227449, PMID:1650008, PMID:12650243, PMID:1713259, PMID:12603745, PMID:12732947, PMID:3900035, PMID:3110008, PMID:9349809, PMID:11553538, PMID:1929326, PMID:11743194]
Unigene542gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene597gi|BAE06007.1|ARO:3003698|mexPARO:3003698mexPMexP is the membrane fusion protein of the MexPQ-OpmE multidrug efflux complex" [PMID:16301811)]
Unigene599gi|39546293|ARO:3000791|mdsCARO:3000791mdsCMdsC is the outer membrane channel of the multidrug and metal efflux complex MdsABC." [PMID:20497225, PMID:17919284]
Unigene652gi|214027186|ARO:3000413|sul3ARO:3000413sul3Sul3 is a sulfonamide resistant dihydropteroate synthase similar to Sul1 and Sul2. Its resistance gene was found encoded in E. coli plasmid DNA of sulfonamide resistant isolates." [PMID:12604565]
Unigene734gi|1788713|ARO:3000833|evgSARO:3000833evgSEvgS is a sensor protein that phosphorylates the regulatory protein EvgA." [PMID:11914367]
Unigene773gi|88195144|ARO:3000839|arlSARO:3000839arlSArlS is a protein histidine kinase that phosphorylates ArlR, a promoter for norA expression." [PMID:10633099]
Unigene781gi|40363826|ARO:3002925|vanRFARO:3002925vanRFvanRF is a vanR variant found in the vanF gene cluster" [PMID:15980329]
Unigene892gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene944gi|40850658|ARO:3002894|otrCARO:3002894otrCotrC is a tetracycline resistance efflux pump found in Streptomyces rimosus" []
Unigene945gi|15834091|ARO:3000830|cpxAARO:3000830cpxACpxA is a membrane-localized sensor kinase that is activated by envelope stress. It starts a kinase cascade that activates CpxR, which promotes efflux complex expression." [PMID:22496764]
Unigene946gi|220901854|ARO:3002928|vanRMARO:3002928vanRMvanRM is a vanR variant found in the vanM gene cluster" [PMID:20733041]
Unigene966gi|57652085|ARO:3000489|sav1866ARO:3000489sav1866Sav1866 is a multidrug efflux pump in the Gram-positive Staphylococcus aureus. It is a homolog of the human ABC transporter Mdr1 and pumps out toxic compounds including verapamil, tetraphenylphosphorchloride, and Hoechst 33342." [PMID:16943773, PMID:17303126]
Unigene967gi|57652085|ARO:3000489|sav1866ARO:3000489sav1866Sav1866 is a multidrug efflux pump in the Gram-positive Staphylococcus aureus. It is a homolog of the human ABC transporter Mdr1 and pumps out toxic compounds including verapamil, tetraphenylphosphorchloride, and Hoechst 33342." [PMID:16943773, PMID:17303126]
Unigene969gi|1788713|ARO:3000833|evgSARO:3000833evgSEvgS is a sensor protein that phosphorylates the regulatory protein EvgA." [PMID:11914367]
Unigene1023gi|15599401|ARO:3000807|mexHARO:3000807mexHMexH is the membrane fusion protein of the efflux complex MexGHI-OpmD." [PMID:15817779, PMID:12917802]
Unigene1024gi|AAG07763.1|ARO:3003031|mexWARO:3003031mexWMexW is the RND-type membrane protein of the efflux complex MexVW-OprM." [PMID:12951344]
Unigene1048gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene1098gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene1099gi|57652085|ARO:3000489|sav1866ARO:3000489sav1866Sav1866 is a multidrug efflux pump in the Gram-positive Staphylococcus aureus. It is a homolog of the human ABC transporter Mdr1 and pumps out toxic compounds including verapamil, tetraphenylphosphorchloride, and Hoechst 33342." [PMID:16943773, PMID:17303126]
Unigene1156gi|40363826|ARO:3002925|vanRFARO:3002925vanRFvanRF is a vanR variant found in the vanF gene cluster" [PMID:15980329]
Unigene1165gi|88195144|ARO:3000839|arlSARO:3000839arlSArlS is a protein histidine kinase that phosphorylates ArlR, a promoter for norA expression." [PMID:10633099]
Unigene1364gi|388534892|ARO:3000776|adeCARO:3000776adeCAdeC is the outer membrane factor of the AdeABC multidrug efflux complex. It can be replaced by other outer membrane channels, and is not essential for antibiotic resistance." [PMID:21173183]
Unigene1402gi|39414|ARO:3002648|APH(3')-IVaARO:3002648APH(3')-IVaAPH(3')-IVa is a chromosomal-encoded aminoglycoside phosphotransferase in B. circulans" [PMID:3006668]
Unigene1430gi|437315|ARO:3002987|bcrAARO:3002987bcrAbcrA is an ABC transporter found in Bacillus licheniformis that confers bacitracin resistance" [PMID:7476193]
Unigene1438gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene1450gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene1491gi|77380201|ARO:3002972|vanTGARO:3002972vanTGvanTG is a vanT variant found in the vanG gene cluster" [PMID:16723588]
Unigene1544gi|151221540|ARO:3000838|arlRARO:3000838arlRArlR is a response regulator that binds to the norA promoter to activate expression. ArlR must first be phosphorylated by ArlS." [PMID:10633099]
Unigene1584gi|444896800|ARO:3000816|mtrAARO:3000816mtrAMtrA is a transcriptional activator of the MtrCDE multidrug efflux pump of Neisseria gonorrhoeae." [PMID:10417654]
Unigene1587gi|99079595|ARO:3002882|lmrDARO:3002882lmrDlmrD is a chromosomally-encoded efflux pump that confers resistance to lincosamides in Streptomyces lincolnensis and Lactococcus lactis. It can dimerize with lmrC" [PMID:16958846]
Unigene1608gi|437315|ARO:3002987|bcrAARO:3002987bcrAbcrA is an ABC transporter found in Bacillus licheniformis that confers bacitracin resistance" [PMID:7476193]
Unigene1616gi|1181627|ARO:3002841|vatBARO:3002841vatBvatB is a plasmid-mediated acetyltransferase found in Staphylococcus aureus" [PMID:8540711]
Unigene1658gi|557879506|ARO:3002941|vanSOARO:3002941vanSOvanSO is a vanS variant found in the vanO gene cluster" [PMID:24342631]
Unigene1673gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene1675gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene1678gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene1681gi|13655509|ARO:3000481|tet35ARO:3000481tet35Tet35 is a tetracycline efflux pump found in the Gram-negative Vibrio and Stenotrophomonas. It is unrelated to other tet resistance genes." [PMID:11897587]
Unigene1725gi|444896800|ARO:3000816|mtrAARO:3000816mtrAMtrA is a transcriptional activator of the MtrCDE multidrug efflux pump of Neisseria gonorrhoeae." [PMID:10417654]
Unigene1742gi|386372244|ARO:3002670|catARO:3002670catcat is used to describe many variants of the chloramphenicol acetyltransferase gene in a range of organisms including Acinetobacter calcoaceticus, Agrobacterium tumefaciens, Bacillus clausii, Bacillus subtilis, Campylobacter coli, Enterococcus faecalis, Enterococcus faecium, Lactococcus lactis, Listeria monocytogenes, Listonella anguillarum\nMorganella morganii, Photobacterium damselae subsp. piscicida, Proteus mirabilis, Salmonella typhi, Serratia marcescens, Shigella flexneri, Staphylococcus aureus, Staphylococcus haemolyticus, Staphylococcus intermedius, Streptococcus agalactiae, Streptococcus suis and Streptomyces acrimycini" [PMID:1461942, PMID:3860383, PMID:3865770, PMID:12726767, PMID:1929282, PMID:11677608, PMID:2013403, PMID:2697637, PMID:19459958, PMID:11735367, PMID:1406372, PMID:1517170, PMID:6950931, PMID:2993795, PMID:2227449, PMID:1650008, PMID:12650243, PMID:1713259, PMID:12603745, PMID:12732947, PMID:3900035, PMID:3110008, PMID:9349809, PMID:11553538, PMID:1929326, PMID:11743194]
Unigene1849gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene1868gi|2769708|ARO:3000118|vgaBARO:3000118vgaBVga(B) is an efflux protein expressed in staphylococci that confers resistance to streptogramin A antibiotics and related compounds. It is associated with plasmid DNA." [PMID:9427556, PMID:15728891]
Unigene1929gi|444896800|ARO:3000816|mtrAARO:3000816mtrAMtrA is a transcriptional activator of the MtrCDE multidrug efflux pump of Neisseria gonorrhoeae." [PMID:10417654]
Unigene1949gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene1964gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene1974gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene1975gi|385203110|ARO:3002522|novAARO:3002522novAA type III ABC transporter, identified on the novobiocin biosynthetic gene cluster, involved in the transport and resistance of novobiocin." [PMID:12604514]
Unigene2002gi|1800070|ARO:3000027|emrAARO:3000027emrAEmrA is a membrane fusion protein, providing an efflux pathway with EmrB and TolC between the inner and outer membranes of E. coli, a Gram-negative bacterium." [PMID:7730261]
Unigene2055gi|40363826|ARO:3002925|vanRFARO:3002925vanRFvanRF is a vanR variant found in the vanF gene cluster" [PMID:15980329]
Unigene2072gi|154685028|ARO:3002814|clbAARO:3002814clbAclbA is a plasmid-encoded cfr gene found in Bacillus amyloliquefaciens" [PMID:22547628]
Unigene2074gi|NP_252244|ARO:3002985|arnAARO:3002985arnAarnA modifies lipid A with 4-amino-4-deoxy-L-arabinose (Ara4N) which allows gram-negative bacteria to resist the antimicrobial activity of cationic antimicrobial peptides and antibiotics such as polymyxin. arnA is found in E. coli and P. aeruginosa." [PMID:11021929, PMID:15939024]
Unigene2179gi|385203110|ARO:3002522|novAARO:3002522novAA type III ABC transporter, identified on the novobiocin biosynthetic gene cluster, involved in the transport and resistance of novobiocin." [PMID:12604514]
Unigene2216gi|194099140|ARO:3000817|mtrRARO:3000817mtrRMtrR is a repressor of mtrCDE expression. Mutations in mtrR increase multidrug resistance." [PMID:7773394]
Unigene2220gi|385203110|ARO:3002522|novAARO:3002522novAA type III ABC transporter, identified on the novobiocin biosynthetic gene cluster, involved in the transport and resistance of novobiocin." [PMID:12604514]
Unigene2226gi|1736787|ARO:3000829|baeSARO:3000829baeSBaeS is a sensor kinase in the BaeSR regulatory system. While it phosphorylates BaeR to increase its activity, BaeS is not necessary for overexpressed BaeR to confer resistance." [PMID:15716448, PMID:12107134]
Unigene2237gi|40363826|ARO:3002925|vanRFARO:3002925vanRFvanRF is a vanR variant found in the vanF gene cluster" [PMID:15980329]
Unigene2274gi|40850658|ARO:3002894|otrCARO:3002894otrCotrC is a tetracycline resistance efflux pump found in Streptomyces rimosus" []
Unigene2275gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene2357gi|57652085|ARO:3000489|sav1866ARO:3000489sav1866Sav1866 is a multidrug efflux pump in the Gram-positive Staphylococcus aureus. It is a homolog of the human ABC transporter Mdr1 and pumps out toxic compounds including verapamil, tetraphenylphosphorchloride, and Hoechst 33342." [PMID:16943773, PMID:17303126]
Unigene2364gi|143198|ARO:3000495|ErmDARO:3000495ErmDErmD confers MLSb phenotype." []
Unigene2382gi|46700|ARO:3002828|srmBARO:3002828srmBsrmB is an efflux pump found in Streptomyces ambofaciens that confers resistance to spiramycin" [PMID:1612454]
Unigene2399gi|155041|ARO:3002942|vanHAARO:3002942vanHAvanHA, also known as vanH, is a vanH variant in the vanA gene cluster" [PMID:8380148, PMID:16323116]
Unigene2406gi|1788588|ARO:3003578|PmrFARO:3003578PmrFPmrF is required for the synthesis and transfer of 4-amino-4-deoxy-L-arabinose (Ara4N) to Lipid A, which allows gram-negative bacteria to resist the antimicrobial activity of cationic antimicrobial peptides and antibiotics such as polymyxin" [PMID:9570402]
Unigene2426gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene2427gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene2518gi|15834092|ARO:3000831|cpxRARO:3000831cpxRCpxR is a regulator that promotes acrD expression when phosphorylated by a cascade involving CpxA, a sensor kinase." [PMID:22496764]
Unigene2519gi|77380196|ARO:3002937|vanSGARO:3002937vanSGvanSG is a vanS variant found in the vanG gene cluster" [PMID:16723588]
Unigene2547gi|437315|ARO:3002987|bcrAARO:3002987bcrAbcrA is an ABC transporter found in Bacillus licheniformis that confers bacitracin resistance" [PMID:7476193]
Unigene2577gi|46700|ARO:3002828|srmBARO:3002828srmBsrmB is an efflux pump found in Streptomyces ambofaciens that confers resistance to spiramycin" [PMID:1612454]
Unigene2611gi|1788713|ARO:3000833|evgSARO:3000833evgSEvgS is a sensor protein that phosphorylates the regulatory protein EvgA." [PMID:11914367]
Unigene2620gi|1060876|ARO:3000206|emrKARO:3000206emrKemrK is a membrane fusion protein that is a homolog of EmrA. Together with the inner membrane transporter EmrY and the outer membrane channel TolC, it mediates multidrug efflux." [PMID:12501312]
Unigene2703gi|1789666|ARO:3000502|acrFARO:3000502acrFAcrF is a inner membrane transporter, similar to AcrB." [PMID:16267305]
Unigene2723gi|456035|ARO:3000195|tetB(P)ARO:3000195tetB(P)TetB(P) is a tetracycline ribosomal protection protein found on the same operon as tetA(P), a tetracycline efflux protein." [PMID:15837373]
Unigene2769gi|153198|ARO:3002817|carAARO:3002817carAcarA is an ABC transporter involved in macrolide resistance. It is found in Streptomyces thermotolerans" [PMID:1612454]
Unigene2802gi|99079563|ARO:3002881|lmrCARO:3002881lmrClmrC is a chromosomally-encoded efflux pump that confers resistance to lincosamides in Streptomyces lincolnensis and Lactococcus lactis. It can dimerize with lmrD" [PMID:16958846]
Unigene2816gi|77380194|ARO:3000575|vanUARO:3000575vanUVanU is a transcriptional activator of the vanG operon of vancomycin resistance genes." [PMID:11036060, PMID:14617152]
Unigene2842gi|437315|ARO:3002987|bcrAARO:3002987bcrAbcrA is an ABC transporter found in Bacillus licheniformis that confers bacitracin resistance" [PMID:7476193]
Unigene2860gi|56385102|ARO:3000535|macBARO:3000535macBMacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC." [PMID:12832048, PMID:19432486, PMID:16359323]
Unigene2885gi|261607834|ARO:3002845|vatHARO:3002845vatHvatH is a plasmid-mediated acetyltransferase found in Enterococcus faecium" [PMID:20713681]
Unigene2947gi|88194116|ARO:3000026|mepAARO:3000026mepAMepA is an efflux protein regulated by MepR and part of the MepRAB cluster. Its presence in Staphylococcus aureus led to multidrug resistance, while it has also been shown to decrease tigecycline susceptibility." [PMID:15855507, PMID:15855508, PMID:16569840]

document location: summary/6_FunctionalProfiling/CARD/Unigenes_CARD.txt


6.6 PHI database


6.6.1 PHI annotation


The Pathogen-Host Interaction database (PHI-base) (http://www.phi-base.org/) contains expertly curated molecular and biological information on genes proven to affect the outcome of pathogen-host interactions. The database was created and is maintained by researchers at Rothamsted Research and external collaborators since 2005. Since December 2016 PHI-base is part of ELIXIR, the European life-science infrastructure for biological information via its ELIXIR-UK node.


Gene_idIdentityE_valuePHI_AccessionGene_nameProtein_AccessionNCBI_TAX_IDSpeciesPhenotype
Unigene3655.72.5e-118PHI:877MGG_00383EDK03005318829Magnaporthe_oryzaeReduced_virulence
Unigene7024.41.7e-05PHI:1018ABC3AAZ81480318829Magnaporthe_oryzaeLoss_of_pathogenicity
Unigene8944.91.3e-64PHI:3332snf7A0A095CFR8552467Cryptococcus_gattiiloss_of_pathogenicity
Unigene10324.62.8e-14PHI:3591rpfFG3K6H956454Xanthomonas_hortorumreduced_virulence
Unigene12355.91.6e-126PHI:2962glyAC5BEV267780Edwardsiella_ictaluriReduced_virulence
Unigene15534.93.1e-134PHI:440PMR1CAB872455476Candida_albicansReduced_virulence
Unigene17235.41.0e-52PHI:3243lsfAQ02QT9287Pseudomonas_aeruginosareduced_virulence
Unigene18432.22.4e-38PHI:2964AsnBG7TM01129394Xanthomonas_oryzae_pv._OryzicolaReduced_virulence
Unigene18642.31.0e-224PHI:3316gcc1G4MZS3318829Magnaporthe_oryzaereduced_virulence
Unigene24543.21.5e-158PHI:4957I6X8R2Zmp11773Mycobacterium_tuberculosisreduced_virulence
Unigene25528.28.0e-18PHI:2067ABC4MGG_00937148305Magnaporthe_oryzaeLoss_of_pathogenicity
Unigene29735.83.7e-69PHI:3027Vatr1A5CUE128447Clavibacter_michiganensisreduced_virulence
Unigene32427.65.0e-46PHI:1018ABC3AAZ81480318829Magnaporthe_oryzaeLoss_of_pathogenicity
Unigene33438.57.7e-05PHI:3468pIL-1A0A075P597294Pseudomonas_fluorescensreduced_virulence
Unigene34332.91.7e-58PHI:1458GzAra006Q4I7F95518Gibberella_zeaeUnaffected_pathogenicity
Unigene35340.92.7e-10PHI:3332snf7A0A095CFR8552467Cryptococcus_gattiiloss_of_pathogenicity
Unigene35644.45.8e-97PHI:3384FVEG_12530W7N2C1117187Fusarium_verticillioidesunaffected_pathogenicity
Unigene39035.81.5e-164PHI:2469AcrBQ7WTQ9552Erwinia_amylovoraReduced_virulence
Unigene40935.62.0e-51PHI:3243lsfAQ02QT9287Pseudomonas_aeruginosareduced_virulence
Unigene41040.32.6e-30PHI:143CHTAAA333535563Gloeocercospora_sorghiUnaffected_pathogenicity
Unigene41238.41.1e-35PHI:4198B3VA60CovR1314Streptococcus_pyogenesIncreased_virulence_(Hypervirulence)
Unigene41429.81.3e-19PHI:1018ABC3AAZ81480318829Magnaporthe_oryzaeLoss_of_pathogenicity
Unigene41930.58.9e-08PHI:3447orf2C5VY201307Streptococcus_suisincreased_virulence
Unigene42926.47.9e-05PHI:2007HOS4EDK06449148305Magnaporthe_oryzaeUnaffected_pathogenicity
Unigene43929.74.6e-13PHI:4200W0WL00gacS287Pseudomonas_aeruginosaincreased_virulence_(Hypervirulence)
Unigene44033.34.2e-32PHI:3591rpfFG3K6H956454Xanthomonas_hortorumreduced_virulence
Unigene44329.32.8e-13PHI:3091OxyRH3RJ9366269Pantoea_stewartiiunaffected_pathogenicity
Unigene44535.51.6e-21PHI:4991Q2G282PerR1280Staphylococcus_aureusreduced_virulence
Unigene45037.32.0e-134PHI:709RelAAAD50301686Vibrio_choleraeReduced_virulence
Unigene49229.81.3e-29PHI:423VAD1AAV410105207Cryptococcus_neoformansReduced_virulence
Unigene50736.82.2e-10PHI:3468pIL-1A0A075P597294Pseudomonas_fluorescensreduced_virulence
Unigene51638.71.5e-210PHI:2469AcrBQ7WTQ9552Erwinia_amylovoraReduced_virulence
Unigene51920.52.3e-06PHI:140CaSLN1BAA249515476Candida_albicansReduced_virulence
Unigene52027.78.3e-23PHI:2440PidRC5A846337Burkholderia_glumaeReduced_virulence
Unigene52257.65.6e-14PHI:1772GzZC087I1S0535518Gibberella_zeaeReduced_virulence
Unigene54232.29.7e-25PHI:4975Q5WWE3LssB446Legionella_pneumophilareduced_virulence
Unigene54637.62.7e-90PHI:2481rfbCQ8PGL8611301Xanthomonas_citri_subsp._CitriReduced_virulence
Unigene61340.13.7e-166PHI:2062Gph1XP_363893148305Magnaporthe_oryzaeMixed_outcome
Unigene62132.91.9e-35PHI:541LIP1AAU87359332648Botrytis_cinereaUnaffected_pathogenicity
Unigene66627.93.8e-78PHI:5275B7VKI8copA212663Vibrio_tasmaniensisreduced_virulence
Unigene68338.94.5e-07PHI:3207Yvc1A1CLC0746128Aspergillus_fumigatusreduced_virulence
Unigene73432.91.3e-60PHI:2323mhk1E9F082568076Metarhizium_robertsiiReduced_virulence
Unigene75643.01.7e-93PHI:3384FVEG_12530W7N2C1117187Fusarium_verticillioidesunaffected_pathogenicity
Unigene77327.43.8e-25PHI:551HIK1BAB40947318829Magnaporthe_oryzaeUnaffected_pathogenicity
Unigene78131.17.6e-27PHI:5062A0A0K0GI30DetR347Xanthomonas_oryzaereduced_virulence
Unigene80631.83.3e-40PHI:384SPE3-LYS9AAS481125207Cryptococcus_neoformansLoss_of_pathogenicity
Unigene81263.42.0e-30PHI:3005ClpPP637861280Staphylococcus_aureusReduced_virulence
Unigene81328.11.0e-04PHI:3468pIL-1A0A075P597294Pseudomonas_fluorescensreduced_virulence
Unigene83746.81.8e-05PHI:2513GFA1E9R5E2746128Aspergillus_fumigatusMixed_outcome
Unigene84126.17.4e-27PHI:1458GzAra006Q4I7F95518Gibberella_zeaeUnaffected_pathogenicity
Unigene85364.04.2e-24PHI:3384FVEG_12530W7N2C1117187Fusarium_verticillioidesunaffected_pathogenicity
Unigene88327.52.6e-32PHI:4904C4YR40Glr15476Candida_albicansmixed_outcome
Unigene89230.12.1e-13PHI:4975Q5WWE3LssB446Legionella_pneumophilareduced_virulence
Unigene92129.01.3e-20PHI:5305Q88BF1OxyR317Pseudomonas_syringaereduced_virulence
Unigene94129.96.0e-07PHI:2637RpoSO51712139Borrelia_burgdorferiReduced_virulence
Unigene94428.77.6e-24PHI:2067ABC4MGG_00937148305Magnaporthe_oryzaeLoss_of_pathogenicity
Unigene94636.22.8e-34PHI:4198B3VA60CovR1314Streptococcus_pyogenesIncreased_virulence_(Hypervirulence)
Unigene96047.45.0e-180PHI:1385GzC2H048I1RSF75518Gibberella_zeaeUnaffected_pathogenicity
Unigene96623.42.0e-18PHI:267MLT1AAD515945476Candida_albicansReduced_virulence
Unigene96729.58.2e-45PHI:1018ABC3AAZ81480318829Magnaporthe_oryzaeLoss_of_pathogenicity
Unigene96930.81.6e-43PHI:253FOS1AAK274365085Aspergillus_fumigatusReduced_virulence
Unigene98020.71.6e-14PHI:4966F9WWR1sdi11047171Zymoseptoria_triticiunaffected_pathogenicity
Unigene98125.23.1e-08PHI:5300A4VTH4agaR21307Streptococcus_suisreduced_virulence
Unigene99444.42.9e-63PHI:3332snf7A0A095CFR8552467Cryptococcus_gattiiloss_of_pathogenicity
Unigene99639.81.8e-89PHI:2645ClpVQ7WP75518Bordetella_bronchisepticaReduced_virulence
Unigene102432.27.2e-13PHI:2469AcrBQ7WTQ9552Erwinia_amylovoraReduced_virulence
Unigene104828.54.1e-18PHI:1018ABC3AAZ81480318829Magnaporthe_oryzaeLoss_of_pathogenicity
Unigene108329.16.0e-78PHI:849GyrABAC98438337Burkholderia_glumaeChemistry_target
Unigene109525.55.2e-04PHI:2007HOS4EDK06449148305Magnaporthe_oryzaeUnaffected_pathogenicity
Unigene109929.64.2e-17PHI:4975Q5WWE3LssB446Legionella_pneumophilareduced_virulence
Unigene110434.52.7e-73PHI:3663Q87DK1PD06812371Xylella_fastidiosaincreased_virulence_(Hypervirulence)
Unigene114129.92.1e-38PHI:4611Q18A49Opp1496Clostridium_difficileincreased_virulence_(Hypervirulence)
Unigene114725.53.6e-23PHI:5092D0C777PLD1470Acinetobacter_baumanniireduced_virulence
Unigene115629.11.4e-22PHI:5062A0A0K0GI30DetR347Xanthomonas_oryzaereduced_virulence
Unigene116529.44.9e-22PHI:136CaHK1AAC394515476Candida_albicansLoss_of_pathogenicity
Unigene119737.68.9e-66PHI:423VAD1AAV410105207Cryptococcus_neoformansReduced_virulence
Unigene119844.64.4e-54PHI:1133LmepiB9DR515022Leptosphaeria_maculansLoss_of_pathogenicity
Unigene121835.45.8e-10PHI:3009rr01Q9S1K21313Streptococcus_PneumoniaeReduced_virulence
Unigene126436.32.7e-36PHI:5271Q8Y0J2fabG1305Ralstonia_solanacearumlethal
Unigene127049.02.5e-18PHI:3382FVEG_12532W7MS18117187Fusarium_verticillioidesunaffected_pathogenicity
Unigene130140.04.9e-21PHI:2644thioredoxin_1P0AA2890371Salmonella_enterica_serovar_TyphimuriumReduced_virulence
Unigene130329.91.7e-06PHI:5102O51216RelBbu139Borrelia_burgdorferiunaffected_pathogenicity
Unigene132240.04.5e-50PHI:4960A0A0H3JLK2rsmI_1280Staphylococcus_aureusreduced_virulence
Unigene135048.96.5e-118PHI:2632argHQ2FIB51280Staphylococcus_aureusReduced_virulence
Unigene135138.93.4e-32PHI:5232G4MTK2MoARG1318829Magnaporthe_oryzaeloss_of_pathogenicity
Unigene138125.47.7e-40PHI:3039MoSPA2U3MXJ8318829Magnaporthe_oryzaemixed_outcome
Unigene143029.52.1e-24PHI:2067ABC4MGG_00937148305Magnaporthe_oryzaeLoss_of_pathogenicity
Unigene143830.92.7e-22PHI:4975Q5WWE3LssB446Legionella_pneumophilareduced_virulence
Unigene145031.21.8e-17PHI:1018ABC3AAZ81480318829Magnaporthe_oryzaeLoss_of_pathogenicity
Unigene146124.85.7e-05PHI:3207Yvc1A1CLC0746128Aspergillus_fumigatusreduced_virulence
Unigene146228.12.9e-25PHI:3280CoRAS1N4VQQ55465Colletotrichum_orbiculare
Unigene146730.46.3e-33PHI:3644Rv1891cO077411773Mycobacterium_tuberculosisreduced_virulence
Unigene147045.19.5e-49PHI:504LEU2CAA423664932Saccharomyces_cerevisiaeReduced_virulence
Unigene147434.48.2e-81PHI:2638Ilv3AQ4X099746128Aspergillus_fumigatusReduced_virulence
Unigene147649.49.9e-44PHI:358ILV2AAR290845207Cryptococcus_neoformansLoss_of_pathogenicity
Unigene149827.33.6e-11PHI:4955P46359psn992166Yersinia_pestismixed_outcome
Unigene153040.81.8e-55PHI:4961P60392rsmH_1280Staphylococcus_aureusreduced_virulence
Unigene155039.41.4e-17PHI:2644thioredoxin_1P0AA2890371Salmonella_enterica_serovar_TyphimuriumReduced_virulence
Unigene158150.11.1e-93PHI:5343Q93UJ3wcbL28450Burkholderia_pseudomalleireduced_virulence

document location: summary/6_FunctionalProfiling/PHI/Unigenes_PHI.txt



7. Functional analysis of differential genes


7.1 Analysis of differential genes


We took Group.stage1_vs_control as an example.


Unigene_IDDLF001DLF002DLF003CON001CON002CON003meanmean_stage1mean_controllog2FCregulationp_valueq_valuesignificance
Unigene2727720000.010.013.420.5701.14-Infdown0.030.65yes
Unigene2764400000.010.014.790.8001.60-Infdown0.030.65yes
Unigene2802110000.010.014.560.7601.52-Infdown0.030.65yes
Unigene5880180000.010.010.010.0000.01-Infdown0.030.65yes
Unigene30005.970.081.121.2002.39-Infdown0.040.65yes
Unigene1100002.410.810.140.5601.12-Infdown0.040.65yes
Unigene1260002.410.790.010.5301.07-Infdown0.040.65yes
Unigene2050005.330.040.100.9101.82-Infdown0.040.65yes
Unigene2300003.200.241.310.7901.58-Infdown0.040.65yes
Unigene2310003.100.141.630.8101.63-Infdown0.040.65yes
Unigene2760002.060.800.500.5601.12-Infdown0.040.65yes
Unigene2890001.240.500.170.3200.64-Infdown0.040.65yes
Unigene3540004.010.260.400.7801.55-Infdown0.040.65yes
Unigene3580001.430.060.060.2600.51-Infdown0.040.65yes
Unigene4200001.090.060.290.2400.48-Infdown0.040.65yes
Unigene4580002.550.720.430.6201.23-Infdown0.040.65yes
Unigene4980001.860.210.040.3500.70-Infdown0.040.65yes
Unigene6710002.110.320.060.4100.83-Infdown0.040.65yes
Unigene6720002.940.790.330.6801.35-Infdown0.040.65yes
Unigene6780002.750.650.250.6101.22-Infdown0.040.65yes
Unigene6890001.470.270.140.3100.63-Infdown0.040.65yes
Unigene7180001.110.060.020.2000.40-Infdown0.040.65yes
Unigene7600003.370.441.390.8701.73-Infdown0.040.65yes
Unigene7830001.010.090.180.2100.42-Infdown0.040.65yes
Unigene8770001.520.040.330.3100.63-Infdown0.040.65yes
Unigene8860002.200.050.060.3800.77-Infdown0.040.65yes
Unigene9720001.470.320.110.3200.64-Infdown0.040.65yes
Unigene9770000.840.090.050.1600.32-Infdown0.040.65yes
Unigene10900001.220.070.070.2300.46-Infdown0.040.65yes
Unigene11840001.829.840.131.9703.93-Infdown0.040.65yes
Unigene11860002.881.180.530.7701.53-Infdown0.040.65yes
Unigene12140004.540.800.280.9301.87-Infdown0.040.65yes
Unigene13690001.380.070.080.2500.51-Infdown0.040.65yes
Unigene14290001.520.280.300.3500.70-Infdown0.040.65yes
Unigene15720003.130.030.030.5301.06-Infdown0.040.65yes
Unigene15930001.630.130.260.3400.67-Infdown0.040.65yes
Unigene16030002.150.670.350.5301.05-Infdown0.040.65yes
Unigene16490002.330.120.160.4400.87-Infdown0.040.65yes
Unigene16630005.320.050.971.0602.11-Infdown0.040.65yes
Unigene16710003.350.020.510.6501.29-Infdown0.040.65yes
Unigene16900004.310.040.910.8801.75-Infdown0.040.65yes
Unigene16960005.130.070.050.8801.75-Infdown0.040.65yes
Unigene18250001.800.021.210.5001.01-Infdown0.040.65yes
Unigene18950006.210.040.951.2002.40-Infdown0.040.65yes
Unigene19090002.480.490.070.5101.01-Infdown0.040.65yes
Unigene19180001.107.180.071.3902.78-Infdown0.040.65yes
Unigene19770001.460.600.040.3500.70-Infdown0.040.65yes
Unigene22130002.520.380.210.5201.04-Infdown0.040.65yes
Unigene22180005.580.071.041.1102.23-Infdown0.040.65yes
Unigene22460002.240.430.050.4500.91-Infdown0.040.65yes
Unigene23320006.371.100.091.2602.52-Infdown0.040.65yes
Unigene23340008.291.000.131.5703.14-Infdown0.040.65yes
Unigene23870003.290.351.010.7801.55-Infdown0.040.65yes
Unigene24980003.250.360.570.7001.39-Infdown0.040.65yes
Unigene25200001.300.060.260.2700.54-Infdown0.040.65yes
Unigene25280003.771.500.080.8901.78-Infdown0.040.65yes
Unigene25490001.340.370.300.3400.67-Infdown0.040.65yes
Unigene25640002.310.040.240.4300.86-Infdown0.040.65yes
Unigene25840000.640.260.130.1700.34-Infdown0.040.65yes
Unigene26460001.590.100.100.3000.60-Infdown0.040.65yes
Unigene26960001.340.130.140.2700.54-Infdown0.040.65yes
Unigene28870001.520.040.580.3600.71-Infdown0.040.65yes
Unigene29060002.520.060.520.5201.03-Infdown0.040.65yes
Unigene29720002.080.030.600.4500.90-Infdown0.040.65yes
Unigene30090001.580.011.220.4700.94-Infdown0.040.65yes
Unigene30680001.570.030.770.4000.79-Infdown0.040.65yes
Unigene30730001.130.230.370.2900.57-Infdown0.040.65yes
Unigene32150001.850.740.390.5000.99-Infdown0.040.65yes
Unigene33510001.700.300.540.4200.85-Infdown0.040.65yes
Unigene33540002.320.300.320.4900.98-Infdown0.040.65yes
Unigene33660002.070.170.180.4000.81-Infdown0.040.65yes
Unigene33690003.190.110.410.6201.24-Infdown0.040.65yes
Unigene33720001.680.020.600.3800.77-Infdown0.040.65yes
Unigene34720000.980.030.060.1800.36-Infdown0.040.65yes
Unigene35270004.210.070.230.7501.51-Infdown0.040.65yes
Unigene35400002.220.290.480.5001.00-Infdown0.040.65yes
Unigene36110001.980.060.330.4000.79-Infdown0.040.65yes
Unigene36550001.900.030.350.3800.76-Infdown0.040.65yes
Unigene37220005.700.100.831.1002.21-Infdown0.040.65yes
Unigene37270002.500.030.030.4300.86-Infdown0.040.65yes
Unigene37360002.030.060.070.3600.72-Infdown0.040.65yes
Unigene37950003.250.020.230.5801.17-Infdown0.040.65yes
Unigene38860005.360.151.161.1102.22-Infdown0.040.65yes
Unigene39300005.200.081.161.0702.15-Infdown0.040.65yes
Unigene40710001.900.050.240.3700.73-Infdown0.040.65yes
Unigene40880002.630.340.850.6401.27-Infdown0.040.65yes
Unigene41470004.920.070.730.9501.91-Infdown0.040.65yes
Unigene41750004.430.290.490.8701.74-Infdown0.040.65yes
Unigene41860004.260.070.910.8701.74-Infdown0.040.65yes
Unigene42770006.170.020.021.0402.07-Infdown0.040.65yes
Unigene43740001.440.240.280.3300.65-Infdown0.040.65yes
Unigene44660001.580.720.600.4800.97-Infdown0.040.65yes
Unigene44690001.471.510.320.5501.10-Infdown0.040.65yes
Unigene44700005.550.041.001.1002.20-Infdown0.040.65yes
Unigene44720001.460.380.340.3600.73-Infdown0.040.65yes
Unigene45360003.401.610.220.8701.74-Infdown0.040.65yes
Unigene46340003.280.010.060.5601.12-Infdown0.040.65yes
Unigene46560001.010.130.070.2000.40-Infdown0.040.65yes
Unigene46890000.680.150.160.1700.33-Infdown0.040.65yes

document location: summary/7_Different_expression/Group.stage1_vs_control/Group.stage1_vs_control_diff_exp.txt


7.2 Volcano of differential unigenes




document location: summary/7_DifferentialExpression/*vs*/*vs*_diff_exp_volcano.png


7.3 Heatmap of differential unigenes




document location: summary/7_DifferentialExpression/*vs*/*vs*_diff_heatmap.png


7.4 Venn diagram of differential unigenes


document location: summary/7_DifferentialExpression/*vs*/*vs*_diff_heatmap.png


7.5 GO enrichment analysis of differential unigenes


Significant GO terms:

GO_IDGO_TermGO_FunctionGO_LevelS Unigene numberTS Unigene numberB Unigene numberTB Unigene numberpvalue
GO:0003735structural constituent of ribosomemolecular_function45352394062513554870.00
GO:0016485protein processingbiological_process75932394070383554870.00
GO:0006518peptide metabolic processbiological_process75392394064283554870.00
GO:0004185serine-type carboxypeptidase activitymolecular_function95282394062933554870.00
GO:0005615extracellular spacecellular_component55762394069983554870.00
GO:0004181metallocarboxypeptidase activitymolecular_function95282394063643554870.00
GO:0004222metalloendopeptidase activitymolecular_function81542394016043554870.00
GO:2000234positive regulation of rRNA processingbiological_process131123940393554870.00
GO:0006096glycolytic processbiological_process72052394023153554870.00
GO:0009311oligosaccharide metabolic processbiological_process767239406073554870.00
GO:0006412translationbiological_process74772394059613554870.00
GO:0015417polyamine-transporting ATPase activitymolecular_function1360239405483554870.00
GO:0015848spermidine transportbiological_process957239405153554870.00
GO:0022625cytosolic large ribosomal subunitcellular_component112452394029013554870.00
GO:0008239dipeptidyl-peptidase activitymolecular_function941239403453554870.00
GO:0008137NADH dehydrogenase (ubiquinone) activitymolecular_function841239403593554870.00
GO:0015344siderophore uptake transmembrane transporter activitymolecular_function767239406673554870.00
GO:0004820glycine-tRNA ligase activitymolecular_function827239402083554870.00
GO:0003746translation elongation factor activitymolecular_function891239409683554870.00
GO:0004565beta-galactosidase activitymolecular_function832239402683554870.00
GO:0006950response to stressbiological_process445239404173554870.00
GO:0043171peptide catabolic processbiological_process839239403493554870.00
GO:0015847putrescine transportbiological_process964239406473554870.00
GO:0008449N-acetylglucosamine-6-sulfatase activitymolecular_function7923940423554870.00
GO:00086943-octaprenyl-4-hydroxybenzoate carboxy-lyase activitymolecular_function7923940423554870.00
GO:0046983protein dimerization activitymolecular_function535239403073554870.00
GO:0004825methionine-tRNA ligase activitymolecular_function828239402303554870.00
GO:0006177GMP biosynthetic processbiological_process1233239402863554870.00
GO:0006508proteolysisbiological_process65172394067783554870.00
GO:0003921GMP synthase activitymolecular_function632239402783554870.00
GO:0051480regulation of cytosolic calcium ion concentrationbiological_process11523940153554870.00
GO:0050270S-adenosylhomocysteine deaminase activitymolecular_function717239401183554870.00
GO:0046373L-arabinose metabolic processbiological_process1023239401813554870.00
GO:0015648lipid-linked peptidoglycan transporter activitymolecular_function61323940803554870.00
GO:0071976cell glidingbiological_process7923940453554870.00
GO:0009758carbohydrate utilizationbiological_process425239402043554870.00
GO:0015846polyamine transportbiological_process518239401303554870.00
GO:0006814sodium ion transportbiological_process81092394012383554870.00
GO:0050242pyruvate, phosphate dikinase activitymolecular_function71423940913554870.00
GO:0016692NADH peroxidase activitymolecular_function724239401953554870.00
GO:0003922GMP synthase (glutamine-hydrolyzing) activitymolecular_function732239402863554870.00
GO:0022627cytosolic small ribosomal subunitcellular_component121152394013273554870.00
GO:0008410CoA-transferase activitymolecular_function619239401453554870.00
GO:0042277peptide bindingmolecular_function520239401563554870.00
GO:0005773vacuolecellular_component955239405653554870.00
GO:0006431methionyl-tRNA aminoacylationbiological_process1328239402453554870.00
GO:0060674placenta blood vessel developmentbiological_process722394023554870.00
GO:0015945methanol metabolic processbiological_process8423940113554870.00
GO:0015279store-operated calcium channel activitymolecular_function10423940113554870.00
GO:0017186peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferasebiological_process10423940113554870.00
GO:0016603glutaminyl-peptide cyclotransferase activitymolecular_function7423940113554870.00
GO:0045454cell redox homeostasisbiological_process688239409873554870.00
GO:0019201nucleotide kinase activitymolecular_function832394063554870.01
GO:0000428DNA-directed RNA polymerase complexcellular_component865239406973554870.01
GO:0019809spermidine bindingmolecular_function5523940183554870.01
GO:0004332fructose-bisphosphate aldolase activitymolecular_function739239403793554870.01
GO:0000922spindle polecellular_component10523940193554870.01
GO:0003899DNA-directed RNA polymerase activitymolecular_function8922394010563554870.01
GO:0042744hydrogen peroxide catabolic processbiological_process624239402103554870.01
GO:0015682ferric iron transportbiological_process10923940533554870.01
GO:0047315kynurenine-glyoxylate transaminase activitymolecular_function832394073554870.01
GO:0008544epidermis developmentbiological_process932394073554870.01
GO:0004563beta-N-acetylhexosaminidase activitymolecular_function835239403413554870.01
GO:0004816asparagine-tRNA ligase activitymolecular_function822239401913554870.01
GO:0006421asparaginyl-tRNA aminoacylationbiological_process1322239401913554870.01
GO:00061032-oxoglutarate metabolic processbiological_process91023940643554870.01
GO:0071453cellular response to oxygen levelsbiological_process618239401473554870.01
GO:0070417cellular response to coldbiological_process619239401593554870.01
GO:0071472cellular response to salt stressbiological_process718239401483554870.01
GO:0050982detection of mechanical stimulusbiological_process6423940143554870.01
GO:0042254ribosome biogenesisbiological_process673239408283554870.01
GO:0005590collagen type VII trimercellular_component722394033554870.01
GO:0030134ER to Golgi transport vesiclecellular_component1222394033554870.01
GO:0000806Y chromosomecellular_component1122394033554870.01
GO:0033116endoplasmic reticulum-Golgi intermediate compartment membranecellular_component1022394033554870.01
GO:0048509regulation of meristem developmentbiological_process922394033554870.01
GO:0046513ceramide biosynthetic processbiological_process822394033554870.01
GO:0001130bacterial-type RNA polymerase transcription factor activity, sequence-specific DNA bindingmolecular_function532394083554870.01
GO:0000706meiotic DNA double-strand break processingbiological_process532394083554870.01
GO:0003094glomerular filtrationbiological_process832394083554870.01
GO:0004494methylmalonyl-CoA mutase activitymolecular_function617239401403554870.01
GO:0009228thiamine biosynthetic processbiological_process91282394015623554870.01
GO:0071469cellular response to alkaline pHbiological_process718239401523554870.01
GO:0009113purine nucleobase biosynthetic processbiological_process1039239404013554870.01
GO:0004020adenylylsulfate kinase activitymolecular_function7723940393554870.01
GO:0015035protein disulfide oxidoreductase activitymolecular_function774239408493554870.02
GO:0016832aldehyde-lyase activitymolecular_function640239404163554870.02
GO:0089705protein localization to outer membranebiological_process6623940313554870.02
GO:0010411xyloglucan metabolic processbiological_process9923940593554870.02
GO:0005416cation:amino acid symporter activitymolecular_function91023940693554870.02
GO:0000462maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)biological_process1327239402603554870.02
GO:0009793embryo development ending in seed dormancybiological_process516239401333554870.02
GO:0016150translation release factor activity, codon nonspecificmolecular_function1023239402133554870.02
GO:0005978glycogen biosynthetic processbiological_process970239408043554870.02
GO:0019464glycine decarboxylation via glycine cleavage systembiological_process1130239402973554870.02
GO:0008790arabinose isomerase activitymolecular_function713239401013554870.02
GO:0008736L-fucose isomerase activitymolecular_function713239401013554870.02
GO:0000910cytokinesisbiological_process723239402143554870.02
GO:0019152acetoin dehydrogenase activitymolecular_function7623940323554870.02
GO:0008615pyridoxine biosynthetic processbiological_process947239405093554870.02

document location:

summary/7_DifferentialExpression/*vs*/*vs*_GO_enrichment.xlsx

summary/7_DifferentialExpression/*vs*/*vs*_GO_enrichment_Unigene.xlsx


Barplot of enriched GO terms:



document location: summary/7_DifferentialExpression/*vs*/*vs*_GO_enrichment_barplot.png


Scatterplot of GO enrichment:



document location: summary/7_DifferentialExpression/*vs*/*vs*_GO_enrichment_scatterplot.png


7.6 KEGG enrichment analysis of differential unigenes


Significant KEGG pathways:

PathwayEntryPathwayDefinitionS Unigene numberTS Unigene numberB Unigene numberTB Unigene numberpvalue
map03010Ribosome7051913081362812850.00
map00511Other glycan degradation3931913046352812850.00
map00600Sphingolipid metabolism2691913033192812850.00
map00195Photosynthesis16191301052812850.00
map00970Aminoacyl-tRNA biosynthesis5451913071192812850.00
map00562Inositol phosphate metabolism981913011072812850.01
map00230Purine metabolism117619130161182812850.01
map04614Renin-angiotensin system23191301912812850.01
map01501beta-Lactam resistance5761913076572812850.01
map03020RNA polymerase1071913012372812850.01
map00121Secondary bile acid biosynthesis25191302202812850.01
map05143African trypanosomiasis14191301042812850.01
map01503Cationic antimicrobial peptide (CAMP) resistance4241913056422812850.02
map04974Protein digestion and absorption41191304352812850.02
map04139Regulation of mitophagy - yeast46191305082812850.03
map00625Chloroalkane and chloroalkene degradation77191309152812850.03
map03030DNA replication4391913059262812850.03
map04514Cell adhesion molecules (CAMs)319130112812850.03
map01055Biosynthesis of vancomycin group antibiotics37191304132812850.05
map04145Phagosome26191302742812850.05
map00730Thiamine metabolism2071913027532812850.07
map00626Naphthalene degradation40191304642812850.07
map00280Valine, leucine and isoleucine degradation1191913015372812850.08
map00563Glycosylphosphatidylinositol(GPI)-anchor biosynthesis719130562812850.08
map04070Phosphatidylinositol signaling system13191301262812850.09
map00620Pyruvate metabolism5461913075922812850.09
map00531Glycosaminoglycan degradation26191302912812850.10
map04640Hematopoietic cell lineage719130582812850.10
map04626Plant-pathogen interaction35191304102812850.10
map00401Novobiocin biosynthesis65191308132812850.10
map00760Nicotinate and nicotinamide metabolism2331913031562812850.10
map04391Hippo signaling pathway -fly319130172812850.10
map01200Carbon metabolism132319130188322812850.11
map00250Alanine, aspartate and glutamate metabolism4691913065262812850.11
map00010Glycolysis / Gluconeogenesis5791913081082812850.11
map00740Riboflavin metabolism1101913014412812850.12
map04330Notch signaling pathway419130282812850.12
map00564Glycerophospholipid metabolism2661913036472812850.12
map00350Tyrosine metabolism1001913013142812850.13
map04726Serotonergic synapse319130192812850.14
map00130Ubiquinone and other terpenoid-quinone biosynthesis1011913013322812850.14
map00514Other types of O-glycan biosynthesis719130642812850.14
map05030Cocaine addiction219130102812850.14
map00910Nitrogen metabolism2311913031702812850.15
map00640Propanoate metabolism2871913039692812850.15
map05134Legionellosis48191306042812850.15
map00680Methane metabolism4461913062512812850.15
map05231Choline metabolism in cancer519130422812850.15
map04141Protein processing in endoplasmic reticulum1101913014682812850.16
map05014Amyotrophic lateral sclerosis (ALS)719130662812850.16
map00480Glutathione metabolism941913012592812850.19
map05230Central carbon metabolism in cancer619130572812850.19
map00052Galactose metabolism5951913084482812850.19
map04917Prolactin signaling pathway11913032812850.19
map04072Phospholipase D signaling pathway11913032812850.19
map04950Maturity onset diabetes of the young11913032812850.19
map04728Dopaminergic synapse219130122812850.19
map05031Amphetamine addiction219130122812850.19
map00260Glycine, serine and threonine metabolism4381913061882812850.20
map05152Tuberculosis419130342812850.20
map05164Influenza A319130252812850.24
map00254Aflatoxin biosynthesis419130372812850.24
map04390Hippo signaling pathway11913042812850.25
map04621NOD-like receptor signaling pathway519130502812850.25
map03013RNA transport781913010652812850.26
map04214Apoptosis - fly219130152812850.27
map04520Adherens junction519130522812850.28
map04725Cholinergic synapse519130522812850.28
map05010Alzheimer's disease12191301452812850.28
map00785Lipoic acid16191302002812850.29
map04724Glutamatergic synapse519130532812850.29
map04144Endocytosis50191306772812850.29
map00220Arginine biosynthesis2461913034942812850.29
map04020Calcium signaling pathway23191302982812850.30
map04670Leukocyte transendothelial migration11913052812850.30
map00905Brassinosteroid biosynthesis11913052812850.30
map00521Streptomycin biosynthesis1911913027052812850.31
map03021Transcription machinery319130292812850.32
map00332Carbapenem biosynthesis31191304142812850.32
map012102-Oxocarboxylic acid metabolism3731913053512812850.32
map04080Neuroactive ligand-receptor interaction219130172812850.32
map00051Fructose and mannose metabolism4041913058122812850.33
map04711Circadian rhythm - fly11913062812850.34
map00624Polycyclic aromatic hydrocarbon degradation219130182812850.35
map00020Citrate cycle (TCA cycle)2871913041252812850.35
map03008Ribosome biogenesis in eukaryotes791913011112812850.36
map03420Nucleotide excision repair2971913042752812850.36
map04113Meiosis - yeast21191302812812850.36
map00290Valine, leucine and isoleucine biosynthesis1831913026212812850.37
map00270Cysteine and methionine metabolism4811913069662812850.37
map05034Alcoholism319130322812850.37
map04920Adipocytokine signaling pathway519130592812850.37
map00520Amino sugar and nucleotide sugar metabolism94019130136852812850.38
map03410Base excision repair2231913032092812850.38
map00240Pyrimidine metabolism91419130133102812850.38
map04112Cell cycle - Caulobacter911913012952812850.39
map04550Signaling pathways regulating pluripotency of stem cells11913072812850.39
map00365Furfural degradation11913072812850.39
map05160Hepatitis C11913072812850.39
map00830Retinol metabolism619130742812850.39

document location:

summary/7_DifferentialExpression/*vs*/*vs*_KEGG_enrichment.xlsx

summary/7_DifferentialExpression/*vs*/*vs*_KEGG_enrichment_Unigene.xlsx


Scatterplot of KEGG enrichment:



document location:

summary/7_DifferentialExpression/*vs*/*vs*_KEGG_enrichment_scatterplot.png

summary/7_DifferentialExpression/*VS*/pathway_pics/*.png



8. Contact us


2575 West Bellfort Street

Suite 270

Houston, TX

77054 USA


Local (713) 664-7087

Toll Free: 1-888-528-8818

Fax: (713) 664-8181

http://www.lcsciences.com/