LC Sciences 16S rRNA Sequencing Report



Customer Name#######
Customer Institutaion#######
Customer Email#######
Project ID#######
SalespersonKyle Navel
Emailknavel@lcsciences.com

Your reliable partner in genomics, transcriptomics and proteomics



Introduction

Metagenomic sequencing is used to investigate the genetic material of microbes directly from environmental samples. It provdies information of taxa diversity and species abundance of microbes.

There are two sequencing methods used for metagenomics,

1. 16S rRNA sequencing focuses on the variable coding regions of 16S rRNA. The result reflects species abundance and taxa diversity in the microbial community.

2. Shotgun metagenomic sequencing provides DNA sequences of all microbes in environmental samples. The information of DNA sequences can be used for GO and Pahtway analysis.

In prokaryotes, the sequence of 16S rRNA (1,542 bp) is the coding region of 16S rRNA, which is composed of 9 variable (V1 to V9) and 10 conserved regions (in white). The variable region is highly diverse among species and can be used for taxanomy.






Order Information

1. Sample Information


Table 1:Sample Information


Sample Type XXX
Species Database Bacteria/Archaea
Amplified Region V3+V4

2. Database Information


Table 2:Database Information


Database Version/Date Link
RDP Release 11.3 http://rdp.cme.msu.edu/index.jsp
Greengenes 13_8 http://qiime.org/home_static/dataFiles.html
NCBI 16SMicrobial 2015.03.19 ftp://ftp.ncbi.nlm.nih.gov/blast/db/16SMicrobial.tar.gz
Customized database N/A N/A

2.1 Databases


RDP: The Ribosomal Database Project (RDP) [1] provides annotations of 16S rRNA and other services. The current verison of RDP is 11.3,which includes 3,019,928 annotated sequences of 16S rRNA. More details about the database can be found at http://rdp.cme.msu.edu/index.jsp




Greengenes: Greengenes [2] database is built by the Lawrence Berkeley National Laborator. The current version is 13.8, and it includes 1,262,986 sequences and their annotations. More details about the database can be found at http://greengenes.lbl.gov/cgi-bin/nph-index.cgi




NCBI 16S Microbial Database: The NCBI BioProjects collect 17,608 16S rRNA sequences. The database can be downloaded at ftp://ftp.ncbi.nlm.nih.gov/blast/db/16SMicrobial.tar.gz


3. Tools for Data Analysis


Table 3:Tools for Data Analysis


Analysis Application Verison/Date
PE reads merge FLASH[3] 1.2.8
Data QC FastQC 0.10.1
OTU clustering CD-HIT 4.6.1
OTU statistics R 3.1.0
Alpha diversity QIIME 1.7.0-dev
Beta diversity QIIME 1.7.0-dev
Taxonomy RDR classifier 2.10.1
FigTree 1.4.0
Emperor 0.9.51
QIIME 1.7.0-dev
TUIT 1.0
GraPhlAn 0.9
MetaPhlAn 1.7.7
R 3.1.0




Methodology

1. Library Preparation and Sequencing


The variable regions of 16S rRNA are amplified to build the sequencing library using Illumina's protocol as shown in Figure 1.




Figure 1:16S rRNA Library Preparation


(1) Primer Design and PCR Amplification

50 ng DNA is used and the variable regions of 16S rRNA are amplified using Phusion polymerase for 25-35 PCR cycles. The primer sequences are,


319F ACTCCTACGGGAGGCAGCAG
806R GGACTACHVGGGTWTCTAAT

(2) Illumina Sequencing Library Preparation

The primer (319F/806R) is designed to target the V3 and V4 regions of 16S rRNA about 469 bp. The length may vary among different species. After one cycle of PCR, sequencing adapters and barcodes are added for further amplification. The amplified library is used for sequencing.

(3) PCR AxyPrepTM Mag PCR Normalizer

(4) Sequencing

Illumina cBot system is used to generate clusters for sequencing on MiSeq.


2. Data Analysis


2.1 Pipeline


2 x 300 nt paired-end reads are generated using MiSeq. The barcode informaiton is used to separate data for each sample if multiple samples are applied in one run. For each sample, paired-end reads are merged into single tags according to the overlapped region between pairs. The tags are subsequently filtered by their Phred quality score (Q20 and Q30) to generate the clean data. The clean data are used for OTU clustering and taxanomy analysis. Our in-house script can annotate the taxa to the species level.




Figure 2:16S rRNA Data Analysis Pipeline


2.2 Data Process Level


Standard Analysis 1 Standard Analysis 2 Advanced Analysis
Aanlysis of Raw Data Rank Abundance Curves Phylogenetic Trees
Analysis of Valid Data Species Accumulation Curves Metastats
OTU Clustering OTU Venn Diagrams (Un)weighted Unifrac PCoA
Diversity Indices Sample Clustering (Un)weighted Unifrac Trees
Rarefaction Curves Taxanomy Analysis at the Species Level
Taxanomy Analysis

Note: The 16S rRNA sequencing order includes the standard and advanced analyses. The advanced analysis is free for first time customers.





Results

1. Group Information


Table 4:Group Information


#SampleIDTreatment
S.0.1control
S.1.1treatment1
S.2.1treatment2
S.3.1treatment3
X.0.1control
X.1.1treatment1
X.1.2treatment1
X.2.1treatment2
X.2.2treatment2
X.3.1treatment3
X.3.2treatment3

The table can also be found in src/summary_report/01_rawdata/sample_map.xlsx


2. Analysis of Raw Data


The raw data/reads contain the sequences genearted by the sequencer through base calling. The data are saved in the FASTQ format and each read is recorded in four lines. For example,

@MISEQ04:76:000000000-ABHVH:1:1101:17453:3799 1:N:0:ATCTCGTA

TTCGCTCCCCTAGCTTTCGTCTCTCAGTGTCAGTGTCGGCCCAGCAGAGTGCTTTCGCCGTTGGTGTT

+

GGFDFEGGFGFF < FFGGGGGG8FFGGFF9FFGGGFGGGDGBEGGGGGGGFFGGEFGGGGGGGGGGGGG

The first line shows the read index; the second line shows the sequence; the third line starts with a plus sign; the forth line shows the Phred quality score of each base in the sequence.

The current Phred score is in the Sanger format (starting from Illumina CASAVA verison 1.8 used for base calling). The Sanger format encodes a Phred quality score from 0 to 93 using ASCII 33 to 126. Table 5 shows the correspondence of the Phred quality score, the error rate, and the ASCII character. The Phred quality score Qsanger is calculated using,


Qsanger = -10 log10 p


p is the error rate of the reported base.


Table 5:Correspondence of the Phred Quality Score, the Error rate, and the ASCII Character


Sequencing error rate(p) Sequencing quality(Qsanger) ASCII character
5% 13 .
1% 20 5
0.1% 30
0.01% 40  I

The number of raw reads and their quality scores are reported in Table 6.

Table 6:Analysis of Raw Data


SampleRaw DataQ20%Q30%GC%
ReadBase
S.0.1182389.16M90.9082.2254.66
S.1.1192379.66M91.0382.4254.42
S.2.1191379.61M90.4581.5554.44
S.3.1150987.58M90.7081.9154.35
X.0.1188589.47M91.0382.3754.67
X.1.1188669.47M90.3781.4254.38
X.1.297424.89M90.2081.2554.54
X.2.1176128.84M89.1079.4154.44
X.2.22543212.77M90.8482.0254.44
X.3.1187679.42M90.9382.1154.63
X.3.2165708.32M90.7281.8654.52

The table can also be found in src/summary_report/01_rawdata/ABC_rawdata_stat.xlsx


Description of Headers:


Header Description
Sample Sample name
Raw Data/Read Number of reads
Raw Data/Base Number of bases in millions (M)
Q20% Percentage of bases with the quality score > 20 (error rate < 0.01)
Q30% Percentage of bases with the quality score > 30 (error rate < 0.001)
GC% GC content

3. Analysis of Clean Data


3.1 Raw Data Processing

Following steps are used to derive the clean data.


(1) Trimming the barcode and sequencing adaptor sequences from the raw reads

(2) Merging paried-end reads into single tags

(3) Excluding tags with more than 5% of ambiguous bases (N)

(4) Excluding tags with more than 20% of low quality bases (Phred score < 10)


3.2 Length Distribution of Clean Data

Figure 3 shows the length distriubtion of clean data.



Figure 3:Length Distribution







The table can also be found in src/summary_report/02_cleandata/.*/Clean_Data_len_dist.png


Table 7: Length Distribution


LengthCountPercentage
<20000.00%
200-30010.01%
300-4001662095.00%
400-5008734.99%
>=50000.00%

The table can also be found in src/summary_report/02_cleandata/.*/Clean_Data_len_dist.xlsx


3.3 Per Base Quality of Clean Data


Per base quality of clean data is shown in Figure 4. The x-axis shows the base position in the tag and the y-axis shows the Phred quality score. The quality socre continues to drop towards the 3' end of tags due to accumultative error rates during sequencing.


Figure 4:Per Base Quality of Clean Data







The figure can also be found in src/summary_report/02_cleandata/.*/Clean_Data_per_base_quality.png


Table 8 shows the number of tags and quality scores of clean data for each sample.


Table 8:Number of Tags and Quality Scores of Clean Data for Each Sample


SampleRaw DataValid DataValid%Q20%Q30%GC%
TagBaseTagBase
S.0.1182389.16M174946.93M95.9298.9495.6554.66
S.1.1192379.66M184547.33M95.9398.9495.6954.47
S.2.1191379.61M181597.27M94.8998.7295.0554.56
S.3.1150987.58M144555.82M95.7498.7295.0254.73
X.0.1188589.47M181477.18M96.2398.9595.7054.68
X.1.1188669.47M179227.14M95.0098.8095.2654.35
X.1.297424.89M91833.64M94.2698.8695.3854.54
X.2.1176128.84M165236.64M93.8298.3293.8254.56
X.2.22543212.77M243799.73M95.8698.8295.3054.50
X.3.1187679.42M180097.12M95.9698.9495.6254.73
X.3.2165708.32M158836.38M95.8598.6995.0054.85

Description of Headers:


Header Description
Sample Sample name
Raw Data/Tag Number of tags
Raw Data/Base Number of bases in millions (M)
Valid Data/Tag Number of tags after quality filtering
Valid Data/Base Number of bases in millions (M) after quality filtering
Valid Ratio% Percentage of valid data out of raw data
Q20% Percentage of bases with the quality score > 20 (error rate < 0.01) in valid data
Q30% Percentage of bases with the quality score > 30 (error rate < 0.001) in valid data
GC% GC content in valid data

The table can also be found in src/summary_report/02_cleandata/ABC_cleandata_stat.xlsx


4. OTU Clustering Analysis


The operational taxonomy unit (OTU) is used for taxa diveristy and species abundance. For 16S rRNA sequencing, one OTU is defined as a cluster of tags with the sequence similarity greater than 97% within the cluster. In other words, each OTU represents a species. The cluster analysis of tags is done using CD-HIT and 97% is the cut-off of the sequence similarity within each cluster. The longest tag within the cluster is selected to be the representative sequence.


4.1 OTU Clusters

(1) OTU_expression.xlsx: the number of tags per OTU in each sample


Table 9: Number of Tags per OTU in Each Sample


X.0.1S.0.1X.1.2S.1.1X.1.1X.2.2S.2.1X.2.1X.3.2S.3.1X.3.1
OTU110000000000
OTU201000000000
OTU310000000000
OTU410000000000
OTU500000000100
OTU600000000100
OTU700000010000
OTU800000001000
OTU900000001000
OTU1000000100000
OTU1100010000000
OTU1200000000001
OTU13129524141718316813
OTU14340710576265
OTU1500000000011
OTU16334815869174103320547085
OTU1714104162111212514939
OTU18203154329393542335427
OTU1900000000010
OTU2000010112020
OTU21080785123117
OTU2201001200010
OTU2300000000010
OTU2412223312222
OTU2501100110021
OTU2600000000010
OTU2710121113121
OTU2887145411971382101901159397126
OTU2910000102011
OTU3000000000010
OTU3110002102010
OTU3212121413302
OTU33142799104382
OTU3434414111210127108
OTU3510941771316891112
OTU364241145741576228375435
OTU37142051423321978241920
OTU38252959513696
OTU39915102833392864202525
OTU40153723201725231010
OTU412122133425443034271329
OTU421745847505455123201032
OTU4323123201442
OTU4438142763261
OTU4500000000010
OTU4600001100011
OTU47513610121511571614
OTU4822274292449281515831
OTU491411115251716198920
OTU5014020413426
OTU51100000000312
OTU5200011220021
OTU5300000000010
OTU5403121423190
OTU5500000001011
OTU5600000000010
OTU5700010100010
OTU5801002010011
OTU5912045205024
OTU60000110481282
OTU6101021010121
OTU625783178552988841783571
OTU6301120022010
OTU6411053451133
OTU6500000000010
OTU6600020213010
OTU6700010210012
OTU6800000000010
OTU6910110022021
OTU7001102322412
OTU7121012104015
OTU7200151012124
OTU7300001202111
OTU7411020221223
OTU7500110000010
OTU7600110212010
OTU7710100110010
OTU7813020122110
OTU7910011101214
OTU8015134225213
OTU8100000000010
OTU8212114312023
OTU8310101001110
OTU8410012421014
OTU8501011020010
OTU8600000000020
OTU8700000002010
OTU8801000000010
OTU8901001000011
OTU9000110011314
OTU9120020004110
OTU9200000001000
OTU9300000000100
OTU9400000000101
OTU9500000000100
OTU9600000000100
OTU9700000000200
OTU9800000000100
OTU9900000000100
OTU10000011110101
OTU101456014723178633746538
OTU102541263573027
OTU10320000000100
OTU10400000010100
OTU10500010000100
OTU10600010100100
OTU10700000000100
OTU10800000000100
OTU10900000000010
OTU11000000000010
OTU11100000001000
OTU11201041021001
OTU11300000001000
OTU11400000001000
OTU11500000001000
OTU11600000001000
OTU11700000001000
OTU11820010221000
OTU11900000001000
OTU12000000000100
OTU12100000000100
OTU12200000000100
OTU12300000001100
OTU12400000100100
OTU12530110111101
OTU12600000000100
OTU12700000000500
OTU12800011002101
OTU12900100010101
OTU13012014043202
OTU13100000000100
OTU13200000000100
OTU13300001020101
OTU13402025341402
OTU1358174231724305211025
OTU13600000000100
OTU13710041150102
OTU13800221011103
OTU13900000000100
OTU14000000000100
OTU14100000000100
OTU14200010200101
OTU14310100000101
OTU14411221212201
OTU14500000000100
OTU14621121102101
OTU14700000000100
OTU14800000000100
OTU14900000000100
OTU15000000010000
OTU15110000010000
OTU15200000010000
OTU15300000010000
OTU15400000010001
OTU155000131011002
OTU15600000001000
OTU15700000001000
OTU15800000001000
OTU15900004168000
OTU16000000001000
OTU16100000001000
OTU16261701551115330016
OTU16300000001000
OTU164010210121002
OTU16500000001000
OTU16600000032001
OTU16713013236103
OTU16800000001000
OTU1696621049113007
OTU17000000001000
OTU17100000001000
OTU17200000001000
OTU17300001101001
OTU17400000001000
OTU17500000102000
OTU17600010011000
OTU17700000002001
OTU17800000001000
OTU17928373977108
OTU18000000002000
OTU181020343615001
OTU18200000001000
OTU18300000101000
OTU18400000001000
OTU18501000112004
OTU18600410211001
OTU18700000121000
OTU18800011001000
OTU18900000001000
OTU19000000001000
OTU19101116349001
OTU19200000001000
OTU19310110001001
OTU19400000001000
OTU19500000001000
OTU19600001001000
OTU19700000001000
OTU19800000001000
OTU19900000001000
OTU20000000001000
OTU20100000001000
OTU20211000011000
OTU20300000001000
OTU20400000001000
OTU20500120201000
OTU20600000001000
OTU20700000001000
OTU20800020121002
OTU20900014002004
OTU21013052331103
OTU21110000001000
OTU21200000001000
OTU21354152231006
OTU21400000001000
OTU21500000001000
OTU21600000001000
OTU21730000101000
OTU21800000000101
OTU21900000000100
OTU22070001000100
OTU22100000000100
OTU22200000010000
OTU22300000010000
OTU22400000010000
OTU22510100010002
OTU22600001020000
OTU22700000010000
OTU22800000010000
OTU22900000010000
OTU23000000120001
OTU23100000010000
OTU23200000010000
OTU23300000010000
OTU23411000110000
OTU23500000010000
OTU23600000010000
OTU23700000010000
OTU23800000010000
OTU23911011010003
OTU24000010020000
OTU24102003110100
OTU24210000120001
OTU24310010110000
OTU24400000010000
OTU24501000010000
OTU24600000010000
OTU24738144470001
OTU24801010010000
OTU24901000020001
OTU25000000010001
OTU25100010010000
OTU25200001230000
OTU25300000010000
OTU25400000010000
OTU25500000110000
OTU25600000010000
OTU25700000010000
OTU25800000010000
OTU25900000010000
OTU26000000010000
OTU26100000010000
OTU26200000010000
OTU26300000010000
OTU26400000020000
OTU26500000010000
OTU26600000010000
OTU26700000010000
OTU26800000010000
OTU26900000010000
OTU27021003010000
OTU27133256841004
OTU27200001010000
OTU27300000010000
OTU27400000010000
OTU27500000010000
OTU27600000010001
OTU27700001000000
OTU27800000001000
OTU27900000101001
OTU28000000013000
OTU28110000001000
OTU28200000001000
OTU28300000001000
OTU28400000001000
OTU28500000001000
OTU28600000001000
OTU28700000001000
OTU28800002100000
OTU28900000100000
OTU29000000100000
OTU29100000100000
OTU29210000100001
OTU29300000100000
OTU29400000100000
OTU29500001100000
OTU29600000000102
OTU29700000010000
OTU29800000010000
OTU29900000010000
OTU30000000010000
OTU30100000010000
OTU30200000010000
OTU30310000000010
OTU30400001000000
OTU30500001000000
OTU30600001000000
OTU30700011000000
OTU30800001000000
OTU30900001000000
OTU31000001000000
OTU31100100000000
OTU31200000001000
OTU31300000100000
OTU31400010100001
OTU31500000100000
OTU31600000100000
OTU31700000100000
OTU31800100100001
OTU31900000100000
OTU32000000100000
OTU32100000100000
OTU32200000100000
OTU32300000100000
OTU32400001100000
OTU32500020100000
OTU32600000100000
OTU32700000100000
OTU32800000200000
OTU32900000100000
OTU330110164300008
OTU33103030100001
OTU33200000100000
OTU33300000100000
OTU33401000100000
OTU33500000100000
OTU33600000100000
OTU33701000100000
OTU33800000100000
OTU33900000200000
OTU34000000100000
OTU34111000100001
OTU34214003200002
OTU34300000100000
OTU34400000100000
OTU34500100200000
OTU34600010100000
OTU34700000100000
OTU34801000100000
OTU34900000100000
OTU35000000100000
OTU35100000100000
OTU35200000100000
OTU35301000100000
OTU35400000100000
OTU35500000100003
OTU35601000000000
OTU35700010000000
OTU35800010000000
OTU35900010000000
OTU36000010000000
OTU36100000010000
OTU36200000000010
OTU36310112514023
OTU36431022100222
OTU36500000000010
OTU36601004244132
OTU36701102100011
OTU36801130010120
OTU36901013133120
OTU37000001212112
OTU37100000000110
OTU37200000021010
OTU37322020101224
OTU37400001011010
OTU37531238733554
OTU37600000000010
OTU37700011110111
OTU37800000000010
OTU37921000011112
OTU38010000000000
OTU38100104000001
OTU38201022000000
OTU38300001000000
OTU38400001000000
OTU38500001000000
OTU38600001000000
OTU38700001000000
OTU38800001000000
OTU38900012000000
OTU39000001000000
OTU39100001000000
OTU39200001000000
OTU39310001000002
OTU39400001000000
OTU39500001000001
OTU39600001000000
OTU39700001000000
OTU39841472000007
OTU39900001000000
OTU40000001000000
OTU40100021000000
OTU40200001000000
OTU40300100000001
OTU40400100000000
OTU40500000100000
OTU40600000100000
OTU40700000100000
OTU40800000100000
OTU40901000000000
OTU41001000000000
OTU41101000000000
OTU41201000000000
OTU41301000000000
OTU41401000000000
OTU41501000000000
OTU41600010000000
OTU41700010000000
OTU41800010000000
OTU41900010000000
OTU42000010000000
OTU42100010000000
OTU42200010000000
OTU42300010000000
OTU42400010000000
OTU42500010000000
OTU42600010000000
OTU42700010000000
OTU42800010000000
OTU42900010000000
OTU43000010000000
OTU43100010000000
OTU43200010000000
OTU43300010000000
OTU43400010000000
OTU43500010000000
OTU43600010000000
OTU43700010000000
OTU43800010000000
OTU43900010000000
OTU44000210000000
OTU44100010000000
OTU44200010000000
OTU44300010000000
OTU44400011000000
OTU44500010000000
OTU44600010000001
OTU44700010000000
OTU44800000000010
OTU44901000000010
OTU45050000000000
OTU45110000000000
OTU45210000000000
OTU45310000000001
OTU45410000000000
OTU45510000000000
OTU45610000000000
OTU45700001000000
OTU45801100000001
OTU45900100000000
OTU46000200000001
OTU46100100000000
OTU46200100000000
OTU46300200000001
OTU46400100000000
OTU46500100000000
OTU46600100000000
OTU46700100000000
OTU46800100000000
OTU46900000100000
OTU47000020000100
OTU47100000000100
OTU47200000000100
OTU47301000112103
OTU47400001010100
OTU47501013210100
OTU47600000000100
OTU47700050322105
OTU47801000000000
OTU47901000000000
OTU48001000000000
OTU48101000000000
OTU48211000000001
OTU48301000000001
OTU48401000000000
OTU48501000000000
OTU48601000000001
OTU48701000000000
OTU48801000000000
OTU48901000000000
OTU49001000000000
OTU49101000000001
OTU49201000000000
OTU49301000000000
OTU49401000000000
OTU49501000000000
OTU49600010000000
OTU49700010000000
OTU49801010010000
OTU49910000000000
OTU50010000000000
OTU50120000000001
OTU50210000000000
OTU50310000000000
OTU504100000000013
OTU50510000000000
OTU50610000000000
OTU50710000000000
OTU50810000000000
OTU50910000000000
OTU51010000000000
OTU51110000000000
OTU51210000000000
OTU51310000000000
OTU51410000000000
OTU51510000000000
OTU51610000000000
OTU51710000000001
OTU51820000000000
OTU51910000000000
OTU52000001000000
OTU52100100000000
OTU52201001011000
OTU52300000001000
OTU52400000001000
OTU52510100001000
OTU52600000001000
OTU52700000001000
OTU52811011001000
OTU52900000001000
OTU53023041111002
OTU53100000001000
OTU53200000001000
OTU53300000101000
OTU53400000001000
OTU53500000000001
OTU53600000000001
OTU53700000000001
OTU53800000000001
OTU53900000000001
OTU54000000000001
OTU54100000000100
OTU54200001000100
OTU54301000000000
OTU54422132640001
OTU54520000110000
OTU54600000010000
OTU54700000010000
OTU54800000010000
OTU54900000020000
OTU55000000010000
OTU55100000010000
OTU55200000010000
OTU55300000010000
OTU55401010110000
OTU55500000010000
OTU55600000010000
OTU55700000010001
OTU55800000010000
OTU55900000010000
OTU56000000010000
OTU56110000000000
OTU56210000000000
OTU56310000000000
OTU56410000000000
OTU56510000000000
OTU56610000000000
OTU56710000000000
OTU56800100000000
OTU56900000100000
OTU57000000000001
OTU57100000000001
OTU57200000000001
OTU57300000000001
OTU57400000000001
OTU57500000000001
OTU57600000000001
OTU57700000000001
OTU57800000000002
OTU57900000000001
OTU58000000000002
OTU58100000000002
OTU58200000000001
OTU58300000000001
OTU58400000000004
OTU58500000000001
OTU58600000000003
OTU58700000000001
OTU58800000000001
OTU58900000000003
OTU59000000000001
OTU59100000000001
OTU59200000000001
OTU59300000000001
OTU59400000000003
OTU59500000000001
OTU59600000000001
OTU59700000000001
OTU59800000000001
OTU59900000000001
OTU60000000000001
OTU60100000000001
OTU60200000000001
OTU60300000000001
OTU60400000000001
OTU60500000000001
OTU60600000000001
OTU60700000000001
OTU60800000000001
OTU60900000000001
OTU61000000000001
OTU61100000000100
OTU61201000000000
OTU61300000010000
OTU61400000010000
OTU61500000001000
OTU61600010100000
OTU61700001100001
OTU61800010300000
OTU61910010200000
OTU62001010100000
OTU62100000100000
OTU62200000100000
OTU62300000100000
OTU62400000100000
OTU62501000100000
OTU62600000100000
OTU62700111100000
OTU62800010100000
OTU62900000100000
OTU63000000000001
OTU63100011001420
OTU63200000010000
OTU63300001000000
OTU63400001000000
OTU63500011000000
OTU63600001000000
OTU63700001000000
OTU63800001000000
OTU63900001000000
OTU64000000100000
OTU64100000000001
OTU64200010000000
OTU64300010000000
OTU64400020000000
OTU64500010000000
OTU64600010000000
OTU64710010000000
OTU64800010000000
OTU64900010000000
OTU65000000010000
OTU65100000010000
OTU65210000000000
OTU65310001000000
OTU65400001000000
OTU65500001000000
OTU65600100000000
OTU65700100000000
OTU65800100000000
OTU65910200000002
OTU66000100000000
OTU66100100000000
OTU66200000100000
OTU66303000000000
OTU66401000000000
OTU66501000000000
OTU66601000000000
OTU66710010000001
OTU66810000000000
OTU66910000000000
OTU67000100000000
OTU67100000000001
OTU67200000000100
OTU67301000000000
OTU67401000000000
OTU67500000000010
OTU67600000000001
OTU67700000000001
OTU67800000000001
OTU67900000000002
OTU68000000000001
OTU68100000000001
OTU68200000000001
OTU68300000000001
OTU68400000000001
OTU68500000000001
OTU68600000000001
OTU68700000000100
OTU68800000000001
OTU68900000000001
OTU69000000000001
OTU69110000000000
OTU69200000001000
OTU69310000001000
OTU6942727253335433436393326
OTU69510113257122200144510095
OTU69600000000001
OTU69700000000100
OTU69801000000000
OTU69900010000000
OTU70010000000000
OTU70100001000000
OTU70200000001000
OTU70300000100000
OTU70400000010000
OTU70500000010000
OTU70610000010000
OTU707191962919292811181936
OTU70810000000000
OTU70900000000101
OTU71000010000010
OTU71143053735125
OTU71200103010110
OTU71313092196563191723910067258
OTU71400000010000
OTU715169101611386701670416329222611644714511145881341315904
OTU71600000000010
OTU7171831093214595219975418478252
OTU718422946804141107142562
OTU71900000000010
OTU72010000002460
OTU72100000000010
OTU72200000000010
OTU72300001000001
OTU72400000001000
OTU72500000001000
OTU72600000100001
OTU72700010000000
OTU72800000010000
OTU72900010010000
OTU73010000110000
OTU73110000010000
OTU73200000000010
OTU73300000001020
OTU73400000000010
OTU73500000000010
OTU73600000000010
OTU737000012895390
OTU73800000000010
OTU73900000010110
OTU74000021010011
OTU74100000000010
OTU74200000000010
OTU74300000000010
OTU74410000100010
OTU74500000000010
OTU74600000000010
OTU74700000000010
OTU74800000000010
OTU74900000000010
OTU75000000000010
OTU75100000000010
OTU75200000000010
OTU75300000000010
OTU75400000000010
OTU755004615102156123600
OTU75600000000010
OTU75700000000010
OTU75800000000010
OTU75900000000010
OTU76000000000010
OTU76100000110118
OTU76200000100010
OTU76300000000010
OTU76400000000010
OTU76500000000010
OTU76600000000010
OTU76700000000010
OTU76800000000010
OTU76900000000010
OTU77000000000010
OTU77110021100011
OTU77200000000010
OTU77300000000010
OTU77400000000010
OTU77500000001000
OTU77600000000100
OTU77700000000100
OTU77800000000010
OTU77900001000011
OTU78001010000010
OTU78100000000010
OTU78201001200002
OTU78300000100000
OTU78400000000001
OTU78500000000100
OTU78600000000100
OTU78700000000200
OTU78800000000100
OTU78900000000100
OTU79000000000100
OTU79100000000100
OTU79200000000100
OTU79300000000100
OTU79400000000100
OTU79500000000100
OTU79600000000100
OTU79700000000100
OTU79800000000100
OTU79900000100101
OTU80000000000100
OTU80100000000100
OTU80210616414424015
OTU80301000001100
OTU80400000000100
OTU80500000000100
OTU80601200000100
OTU80700000000100
OTU80800000000100
OTU80900000000100
OTU81000000000100
OTU81100000000100
OTU81200000000100
OTU81300000000100
OTU81400000000100
OTU81500000000100
OTU81600000000100
OTU81700000010100
OTU81801101203101
OTU81900000301400
OTU82000000020100
OTU82110000111100
OTU82200000000100
OTU82300000000100
OTU82400000000100
OTU82500000000100
OTU82600000000100
OTU82700000000100
OTU82800000000100
OTU82900000000100
OTU83000000000100
OTU83100000000100
OTU83200000000100
OTU83300000000100
OTU83400000000100
OTU83500000000100
OTU83600000000100
OTU83700000000100
OTU83800000000100
OTU83900000000100
OTU84000000000100
OTU84100000000100
OTU84200100010000
OTU84301000010000
OTU84420010200020
OTU845210440760103
OTU84620002000010
OTU84755511951618567
OTU8482914237125118
OTU84900000000010
OTU85011010100020
OTU85101220220112
OTU85200000000010
OTU85310031110211
OTU85400100000000
OTU85500000013000
OTU85600000001000
OTU85700000001000
OTU85800000001000
OTU85900000001000
OTU86000000001000
OTU86100000001000
OTU86200000001000
OTU86300000002000
OTU86400001001000
OTU86502412023105
OTU86600000001000
OTU86700000001000
OTU86800000001000
OTU86903012161610100064
OTU87000000001000
OTU87100000001000
OTU87200000001000
OTU87300000001000
OTU87400000001000
OTU87500000001000
OTU87600000001000
OTU87700000001000
OTU87800000001000
OTU87901010001000
OTU88000000001000
OTU88100000001000
OTU88200000001000
OTU88300000001000
OTU88400000001000
OTU88500000001000
OTU88600000001000
OTU88700000001000
OTU88800000001000
OTU88900000001000
OTU89001010313000
OTU89100110011000
OTU89200100001000
OTU89300000001000
OTU89400000101001
OTU89500000001000
OTU89600000001000
OTU89700000001000
OTU89800000001000
OTU89900000001000
OTU90000000001000
OTU90100000001000
OTU90200000101000
OTU90300000001000
OTU90400000001000
OTU90500000001000
OTU90600000001000
OTU90700000001002
OTU90800000001000
OTU90900000001000
OTU91000000001000
OTU91100000001000
OTU91200000001000
OTU91300000001000
OTU91400000001000
OTU91500000101001
OTU91600000001000
OTU91700000001000
OTU91800000001000
OTU91900000001000
OTU92000000001000
OTU92100000001000
OTU92200000001000
OTU92300000001000
OTU92400000001000
OTU92500000001000
OTU92600000001000
OTU92700000100003
OTU92800000100000
OTU92900000000100
OTU93000000001100
OTU93100020000000
OTU93200010000000
OTU93300000010000
OTU93410420420002
OTU93500000010000
OTU93600000010000
OTU93700000010000
OTU93800000010000
OTU93900000010000
OTU94000000010000
OTU94100000010000
OTU94200000010000
OTU94300000010000
OTU94400000010000
OTU94500000010000
OTU94600000010000
OTU94700000020000
OTU94800000010000
OTU94900000010000
OTU95000000010000
OTU95100000010000
OTU95200000010000
OTU95300000010000
OTU95400000010000
OTU95500000010000
OTU95600000010000
OTU95700000010000
OTU95800000010000
OTU95910011220001
OTU96000000010000
OTU96100000010000
OTU96200000010000
OTU96300000010000
OTU96400000010000
OTU96500000010000
OTU96600000010000
OTU96700000010000
OTU96800000010000
OTU96900000010000
OTU97000000010000
OTU97100000010000
OTU97200000010000
OTU97300000010000
OTU97400000010000
OTU97500000010000
OTU97600000010000
OTU97700000010000
OTU97800000010000
OTU97900000010000
OTU98000000010000
OTU98100000010000
OTU98200000010000
OTU98300000010000
OTU98400000010000
OTU98500000010000
OTU98600000010000
OTU98700000010000
OTU98800000010000
OTU98900000010000
OTU99000000010000
OTU99100000010000
OTU99200000010000
OTU99300000010000
OTU99400000010000
OTU99500000010000
OTU99600000010000
OTU99700000010000
OTU99810000111110
OTU99900000000010
OTU100000001000000
OTU100100001000000
OTU100200100000000
OTU100300000001000
OTU100400000001000
OTU100500000001000
OTU100600000001000
OTU100700000001000
OTU100800000001000
OTU100900000001000
OTU101011010011000
OTU101111204500001
OTU101200000100000
OTU101304141142305
OTU101400000000100
OTU101500000000100
OTU101600000000101
OTU101710001200100
OTU101800001000100
OTU101901000000100
OTU102000000000100
OTU102100000000100
OTU102200001100100
OTU102310011010205
OTU102402000000000
OTU102501000000000
OTU102600010000000
OTU102700010210000
OTU102800000010000
OTU102900000010000
OTU103000000010000
OTU103100000010000
OTU103200000010000
OTU103300001000010
OTU103410000000000
OTU103500001000000
OTU103600001000000
OTU103711210000005
OTU103800000001000
OTU103900000011001
OTU1040452845730010
OTU104100000001001
OTU104200000001000
OTU104300000001000
OTU104410000001000
OTU104500010001000
OTU104610000001001
OTU104700000100000
OTU104800000100000
OTU104900000100000
OTU105000000100000
OTU105100000100000
OTU105200000100000
OTU105300000100000
OTU105400000100000
OTU105500000100000
OTU105600000100000
OTU105700000100000
OTU105800000100000
OTU105900000100000
OTU106000000100000
OTU106100000100000
OTU106200000100000
OTU106300000100000
OTU106400000100000
OTU106500000100000
OTU106600000100000
OTU106700000100000
OTU106800000100000
OTU106900000100000
OTU107000000100000
OTU107100000100000
OTU107200000100000
OTU107300000100000
OTU107400000100001
OTU107500000100000
OTU107600000100000
OTU107711010300000
OTU107800000100000
OTU107900000100000
OTU108000000100000
OTU108100000100000
OTU108200000100000
OTU108300000100000
OTU108400000100000
OTU108500000100000
OTU108601000200000
OTU108700000100000
OTU108800000100000
OTU108900000100000
OTU109000000100000
OTU109100000100000
OTU109200000100000
OTU109300000100000
OTU109400000100000
OTU109500000100000
OTU109600000100000
OTU109700000100000
OTU109800000100000
OTU109900000100000
OTU110000000100000
OTU110100000100000
OTU110299111467000011
OTU110300000100000
OTU110400000100000
OTU110500001100000
OTU110600000100000
OTU110701030100000
OTU110800000100000
OTU110900000100000
OTU111000000100000
OTU111100000100000
OTU111200000100000
OTU111300000100000
OTU111400000100000
OTU111500000100000
OTU111600000100000
OTU111700000100000
OTU111800000100000
OTU111900000100000
OTU112000000100000
OTU112100000100000
OTU112200000100000
OTU112300000100000
OTU112400000100000
OTU112500000100000
OTU112600000100000
OTU112700000100000
OTU112800000100000
OTU112900000100000
OTU113000000100000
OTU113100000100000
OTU113200000100000
OTU113300000100000
OTU113400000100000
OTU113500000100000
OTU113600000000001
OTU113700000000100
OTU113800020000000
OTU113903034330002
OTU114000000010000
OTU114100000010000
OTU114200001010001
OTU114300000010000
OTU114441202510007
OTU114500000010001
OTU114600000010000
OTU114700000010000
OTU114810000000002
OTU114900001000000
OTU115000001000000
OTU115100001000000
OTU115200001000000
OTU115300001000000
OTU115400001000000
OTU115500001000000
OTU115600001000000
OTU115700001000000
OTU115800001000000
OTU115900001000000
OTU116000001000000
OTU116100001000000
OTU116200001000000
OTU116300001000000
OTU116400001000000
OTU116500001000000
OTU116600001000000
OTU116700001000000
OTU116800001000000
OTU116900001000000
OTU117001111000000
OTU117100001000000
OTU117200001000000
OTU117300001000000
OTU117400001000000
OTU117500001000000
OTU117600001000000
OTU117701001000002
OTU117800001000000
OTU117900001000000
OTU118000001000000
OTU118100001000000
OTU118200001000000
OTU118300001000000
OTU118400001000000
OTU118500001000000
OTU118600001000000
OTU118710001000000
OTU118800001000000
OTU118900001000000
OTU119000001000000
OTU119102101000000
OTU119200001000000
OTU119300001000000
OTU119400001000000
OTU119500001000000
OTU119600001000000
OTU119700001000000
OTU119800001000000
OTU119900001000000
OTU120000001000000
OTU120100001000000
OTU120200001000000
OTU120300001000000
OTU120400001000000
OTU120500001000000
OTU120600000100000
OTU120700000100000
OTU120800000100000
OTU120900000100000
OTU121000000100000
OTU121100000100000
OTU121200000100000
OTU121300000100000
OTU121400000100000
OTU121500000100000
OTU121600000100000
OTU121700000100000
OTU121800000000001
OTU121900000000001
OTU122000000000001
OTU122100010000000
OTU122200010000000
OTU122300010000000
OTU122400010000000
OTU122500010000000
OTU122600010000000
OTU122700010000000
OTU122800010000000
OTU122900010000000
OTU123000010000000
OTU123100010000000
OTU123200010000000
OTU123300010000000
OTU123410020000001
OTU123500010000000
OTU123600010000000
OTU123700010000000
OTU123800010000000
OTU123900010000000
OTU124000010000000
OTU124100010000000
OTU124200010000000
OTU124300010000000
OTU124400010000001
OTU124500010000000
OTU124600010000000
OTU124700010000000
OTU124800010000000
OTU124910010000000
OTU125000010000000
OTU125100010000000
OTU125200010000000
OTU125300010000000
OTU125400010000000
OTU125500010000000
OTU125600010000000
OTU125700010000000
OTU125800010000000
OTU125900010000000
OTU126000010000000
OTU126100010000000
OTU126200010000000
OTU126300010000001
OTU126400010000000
OTU126500010000000
OTU126600010000000
OTU126700010000000
OTU126800010000000
OTU126900010000000
OTU127000010000000
OTU127100010000000
OTU127200010000000
OTU127300010000000
OTU127400010000000
OTU127500010000000
OTU127600010000000
OTU127711001000000
OTU127800001000000
OTU127900001000000
OTU128000001000000
OTU128100001000000
OTU128200001000000
OTU128300001000000
OTU128400001000000
OTU128500001000000
OTU128600001000000
OTU128700001000000
OTU128800100000000
OTU128900100000000
OTU129000100000000
OTU129100100000000
OTU129200100000000
OTU129300100000000
OTU129400100000000
OTU129500100000000
OTU129600100000000
OTU129700100000000
OTU129800100000000
OTU129900100000000
OTU130000100000000
OTU130100100000000
OTU130200100000000
OTU1303023000000010
OTU130400100000000
OTU130500100000001
OTU130600100000000
OTU130700100000000
OTU130800110000001
OTU130900100000000
OTU131000100000000
OTU131100100000000
OTU131200100000000
OTU131300100000000
OTU131400100000001
OTU131500100000000
OTU131600100000000
OTU131700100000000
OTU131800100000000
OTU131900100000000
OTU132000100000000
OTU132100000001000
OTU132200000100000
OTU132300000100000
OTU132410000100000
OTU132500000100000
OTU132610010100000
OTU132700000100000
OTU132800000100001
OTU132900000100000
OTU133000000100000
OTU133101000100000
OTU133200000100000
OTU133300000100000
OTU133400000000001
OTU133500000000001
OTU133601000000000
OTU133701000000000
OTU133801000000000
OTU133901000000000
OTU134001000000000
OTU134101000000000
OTU134201000000000
OTU134301000000000
OTU134401000000000
OTU134501000000000
OTU134601000000000
OTU134701000000000
OTU134801000000000
OTU134901000000000
OTU135001000000000
OTU135101000000000
OTU135201000000000
OTU135301000000000
OTU135401000000000
OTU135501000000000
OTU135601000000000
OTU135701000000000
OTU135801000000000
OTU135901000000000
OTU136001000000000
OTU136101000000000
OTU136201000000000
OTU136301000000000
OTU136401000000000
OTU136501000000000
OTU136601000000000
OTU136701000000000
OTU136801000000000
OTU136901000000000
OTU137001000000000
OTU137101000000000
OTU137201000000000
OTU137300010000000
OTU137401010000001
OTU137500010000000
OTU137600010000000
OTU137710000000000
OTU137810000000000
OTU137910000000000
OTU138010000000000
OTU138110000000000
OTU138210000000000
OTU138310000000000
OTU138410000000000
OTU138510000000000
OTU138610000000000
OTU138710000000000
OTU138810000000000
OTU138910000000000
OTU139010000000000
OTU139110000000000
OTU139210000000000
OTU139310000000000
OTU139410000000000
OTU139510000000001
OTU139610000000000
OTU139710000000000
OTU139840000000000
OTU139910000000000
OTU140010000000000
OTU140110000000000
OTU140210000000000
OTU140310000000000
OTU140410000000000
OTU140520000000000
OTU140610000000000
OTU140710000000000
OTU140810000000000
OTU140910000000000
OTU141010000000000
OTU141110000000000
OTU141210000000000
OTU141310000000000
OTU141410000000000
OTU141510000000000
OTU141610000000000
OTU141710000000000
OTU141810000000000
OTU141910000000000
OTU142010000000000
OTU142110000000000
OTU142210000000000
OTU142310000000000
OTU142410000000000
OTU142510000000000
OTU142610000000000
OTU142710000000000
OTU142810000000000
OTU142910000000000
OTU143010000000000
OTU143110000000000
OTU143210000000000
OTU143310000000000
OTU143410000000000
OTU143510000000000
OTU143600001000000
OTU143700001000000
OTU143800001000000
OTU143900001000000
OTU144000001000000
OTU144100001000002
OTU144210001000000
OTU144300001000001
OTU144400100000000
OTU144500000000001
OTU144601000000000
OTU144701000000000
OTU144801000000000
OTU144911000000000
OTU145000020000000
OTU145100010000000
OTU145200010000001
OTU145300010000000
OTU145400010000000
OTU145500010000000
OTU145600010000000
OTU145700010000000
OTU145800010000000
OTU145910000000000
OTU146010000000000
OTU146110000000000
OTU146210000000000
OTU146310000000000
OTU146410000000000
OTU146500001000000
OTU146600001000000
OTU146700001000000
OTU146800001000000
OTU146900100000000
OTU147000100000000
OTU147100100000000
OTU147200100000000
OTU147300000000001
OTU147400000000001
OTU147500000000001
OTU147600000000001
OTU147700000000001
OTU147800000000001
OTU147900000000001
OTU148000000000001
OTU148100000000001
OTU148200000000001
OTU148300000000001
OTU148400000000001
OTU148500000000001
OTU148600000000001
OTU148700000000001
OTU148800000000001
OTU148900000000009
OTU149000000000001
OTU149100000000001
OTU149200000000001
OTU149300000000001
OTU149400000000001
OTU149500000000001
OTU149600000000001
OTU149700000000001
OTU149800000000001
OTU149900000000001
OTU150000000000001
OTU150100000000001
OTU150200000000001
OTU150300000000001
OTU150400000000001
OTU150500000000001
OTU150600000000001
OTU150700000000001
OTU150800000000001
OTU150900000000001
OTU151000000000001
OTU151100000000001
OTU151200000000001
OTU151300000000001
OTU151400000000001
OTU151500000000001
OTU151600000000001
OTU151700000000002
OTU151800000000001
OTU151900000000001
OTU152000000000001
OTU152100000000001
OTU152200000000001
OTU152300000000001
OTU152400000000001
OTU152500000000001
OTU152600000000001
OTU152701000000000
OTU152801000000000
OTU152901000000000
OTU153001000000000
OTU153101000000000
OTU153201000000000
OTU153301000000000
OTU153401000000000
OTU153501000000000
OTU153601000000000
OTU153701000000000
OTU153810000000000
OTU153910000000000
OTU154020000000001
OTU154110000000000
OTU154210000000000
OTU154310000000000
OTU154400100000000
OTU154500000000001
OTU154600000000001
OTU154700000000001
OTU154800000000001
OTU154900000000001
OTU155000000000001
OTU155100000000001
OTU155200000000001
OTU155300000000001
OTU155401000000002
OTU155500010000000
OTU155610000000000
OTU155710000000000
OTU155800000000001
OTU155900000000001
OTU156000000000001
OTU156100000000001
OTU156200000000001
OTU156300000000001
OTU156400000000001
OTU156501000100001
OTU156600000000001
OTU156700000000001
OTU156800000000001
OTU156900000000100
OTU157000000000001
OTU157100000100000
OTU157200100000000
OTU157301100011012


ps: Each row shows the number of tags per OTU; each column shows the number of tags in each sample.

(2) OTU_map.xlsx:each row shows tag indices in each OTU. The tag index is starting with the sample name, and the sample name is followed by an index number.

(3) OTU_table.biom:number of tags and annotations per OTU in each sample. The Biological Observation Matrix (BIOM) [15] is a public format for representing biological samples by observation contingency tables. The BIOM format is recognized by the Earth Microbiome Project and supported by the Genomics Standards Consortium. Applications like QIIME[8], MG-RAST[16], PICRUSt[13], etc. have used the format to save data for further analysis. More details can be found at http://biomformat.org/

(4) OTU_table statistics.xlsx:statistics of OTUs


4.2 OTU Representative Sequence

The results can be found in src/summary_report/03_OTU_profiling/02_OTU_rep_seqs

(1) OTU rep id.xlsx:representative tag index of each OTU

(2) OTU rep seqs.fasta:representative OTU sequences in the fasta format


4.3 OTU Venn Diagram

The Venn diagram shows the number of common OTUs in differrent samples/groups. It is used to check similarity and specificity of OTUs in different samples/groups.




Figure 5:OTU Venn Diagram







ps: One Venn diagram may contain up to 5 groups for a clear presentation.


The diagrams can also be found in src/summary_report/03_OTU_profiling/03_OTU_venn_graph


4.4 Species Accumulation Curve


The species accumulation curve shows the accumulative number of species in samples with respect to the increasing number of collected samples. The curve is used to determine if sampling is enough to represent the environment. Under the premise of enough sampling, the curve can be used to estimate the abundance of species.



Figure 6:Species Accumulation Curve


ps: The x-axis shows the number of samples randomly selected (500 permutations), and the y-axis shows the number of OTUs in the samples. The curve shows the rate of OTU increasing with respect to the increasing number of samples. The rate of OTU increasing usually slows down when more samples are included, which means the number of samples is enough to represent the environment. Otherwise, more samples need to be collected for further analysis.


The figure can also be found in src/summary_report/03_OTU profiling/04_species_accumulation_curve.png


5. Alpha Diversity


Alpha diversity (within-habitat diversity) is a measurement of the variety of organisms that inhabit a defined region or habitat.


5.1 Diversity Indices


Observed Species Index

The index is equal to the number of species in the sample. For 16S rRNA sequencing, the observed species index is equal to the OTU number in the sample.


Shannon Index

The Shannon index is calcuated using,



H' is the Shannon index; S is the total number of OTUs; pi is the ratio of the tag number of the ith OTU to the total number of tags. A greater Shannon index indicates higher diversity in the sample.


Simpson Index

The Simpson index is calculated using,



S is the total number of OTUs; pi is the ratio of the tag number of the ith OTU to the total number of tags. The index shows the probability of two randomly selected tags belonging to different OTUs. A greater Simpson index indicates higher diversity in the sample. For example, the Simpson index will be zero if there is only one OTU, which stands for the lowest diversity.


Chao1 Index

The Chao1 index is used to estimate the total number of OTUs in the sample and it is calcuated using,



S1 is the estimated number of OTUs; Sobs is the observed number of OTUs; F1 is the number of OTUs containing only one tag; F2 is the number of OTUs containing two tags.


Table 10:Alpha Diversity Indices of Each Sample


observed_speciesshannonsimpsonchao1
X.0.1177.000.750.13804.00
S.0.1159.000.850.15486.35
X.3.2155.000.840.16583.21
S.2.1194.001.000.18496.88
X.2.1196.001.210.23589.14
X.2.2186.000.910.16597.71
S.1.1180.001.010.18434.38
X.3.1245.001.250.23938.05
S.3.1138.000.760.14623.67
X.1.1167.000.920.17353.58
X.1.2163.000.650.11484.32

Only partial results will be shown if there are too many samples.


The full table can also be found in src/summary_report/04_alpha_diversity/01_alpha_diversity.xlsx


5.2 Rarefaction Curves


The rarefaction curve shows the diversity index with respect to the number of randomly selected tags. The diversity among samples can be observed from the rarefaction curves of each sample. The number of OTUs increases when more tags are included. The inceasing rate slows down when a certain number of tags is included, which indicates that the coverage of sequencing is deep enough to represent almost all species in the sample.



Figure 7: Rarefaction Curves


The charts can also be found in src/summary_report/04_alpha_diversity/02_rarefaction_result/rarefaction_plots.html


5.3 Rank Abundance Curves


The rank abundance curve shows the relative abundance with respect to the rank of OTUs. The relative abundance is the number of tags in one OTU devided by the total number of tags, and OTUs in x-axis are sorted by the number of tags in each OTU.

The curve indicates species abundance and uniformity. A smooth curve means that the number of tags in each OTU is more uniform, and species abundance is higher in the sample.



Figure 8: Rank Abundance Curves


The charts can also be found in src/summary_report/04_alpha_diversity/03_rank_abundance_graph.png


6. Beta Diversity


Beta diversity shows the differentiation among habitats. The analysis can be done using a matrix containing the distance between samples.


6.1 Sample Distance Matrix

The distance between samples is calculated using three methods, euclidean, unweighted unifrac[17], and weighted unifrac[17].


6.2 Sample Clustering

Based on the distance matrix, clustering is done using an Unweighted Pair Group Method with Arithmetic Mean (UPGMA), and a file with an extension .tre is gerenated in the newick format. The file can be imported into a graphic viewer, e.g., FigTree (http://tree.bio.ed.ac.uk/software/figtree/), to plot a phylogenetic tree as shown in Figure 9.




Figure 9: Beta Diversity and Sample Clusters







The results can also be found in src/summary_report/05_beta_diversity/02_upgma_cluster


6.3 Sample PCoA


The Principal Coordinates Analysis (PCoA) is used to differentiate samples according to data features. The feature is derived from the distance matrix of samples. One way is to observe the similarity or difference of the data used. It is based on the similarity matrix or sample distance matrix, calculate the sample in a low-dimensional space, such as a three-dimensional position coordinate space. Its principle is eigenvalue analysis, by finding a series of eigenvalues of the matrix, the eigenvalues in descending order, sorted first as the most important characteristic value to it as the first axis. And principal component analysis PCA (Principal Components analysis) similar ideas, but there are differences. Principal component analysis has nothing to do by finding a linear matrix vector data dimensionality reduction, these linearly independent vectors is called the main component, the first principal component explains the largest variance or volatility of the data portion. In addition, PCA analysis commonly used Euclidean distance calculation, and PCoA analysis can take any distance matrix. We can observe the difference between a single sample or sample group by PCoA analysis. By the difference between a single sample can be seen in particular samples.





Figure 10: PCoA


ps: PCoA results can be viewed using the Chrome browser (src/summary_report/07_supplemental_material/Chrome.exe)


The results can also be found in src/summary_report/05_beta_ diversity/03_PCoA_result/*/index.html


7. Taxa Analysis


The taxa analysis is done using the representative tag in each OTU. The representative tags are mapped to RDP, Greengeens, and NCBI 16S Microbial databases to determine the taxanomy.


7.1 Annotation Databases


(1) RDP


The Ribosomal Database Project (RDP, version 11.3) provides a tool (RDP classifier) for alignment of OTU tags to its database containing 3,019,928 16S rRNA and 102,901 Fungus 28S rRNA sequences. The RDP classifier is a naive Bayesian classifier providing taxonomic assignments from domain to genus and the threshold of classification is set to 0.8。


(2) Greengenes


The Greengenes database (version 13.8) is supported by the Lawrence Berkeley National Laboratory. The database contains full-length 16S rRNA sequences and taxonomic annotations. Greengenes can be downloaded at http://qiime.org/home static/dataFiles.html. OTU tags are aligned to the database using a BLAST script implemented in QIIME and the e-value cut-off is set to 10-5.


(3) NCBI 16S Microbial Database


The NCBI 16S microbial database uses the Taxonomic Unit Identification Tool (TUIT) [12] for taxonomy. BLAST [18] is implemented in TUIT to align OTU tags to the 16S rRNA database and the e-value cut-off is set to 10-5.


Table 11: Number of Tags and Taxanomy Annotations of OTUs


#OTU IDX.0.1S.0.1X.3.2S.2.1X.2.1X.2.2S.1.1X.3.1S.3.1X.1.1X.1.2taxonomy
OTU11.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU20.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU31.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU41.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU50.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU60.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU70.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__johnsonii
OTU80.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Raphanus; s__sativus
OTU90.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Raphanus; s__sativus
OTU100.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Raphanus; s__sativus
OTU110.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Raphanus; s__sativus
OTU120.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU1312.009.0016.0018.003.0017.0024.0013.008.0014.005.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Enhydrobacter; s__unclassified
OTU143.004.002.007.006.005.007.005.006.0010.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU150.000.000.000.000.000.000.001.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__rhizosphaerae
OTU1633.0048.0054.00103.00320.0074.0086.0085.0070.0091.0015.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU1714.0010.0014.0021.0025.0011.0016.0039.009.0021.004.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU1820.0031.0033.0035.0042.0039.0043.0027.0054.0029.005.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__unclassified
OTU190.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Desulfuromonadales; f__Geobacteraceae; g__Geobacter; s__Geobacter anodireducens
OTU200.000.000.001.002.001.001.000.002.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU210.008.001.001.0023.005.007.007.001.008.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU220.001.000.000.000.002.000.000.001.001.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Enterococcaceae; g__Enterococcus; s__unclassified
OTU230.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__unclassified
OTU241.002.002.001.002.003.002.002.002.003.002.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU250.001.000.001.000.001.000.001.002.000.001.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Brachymonas; s__Brachymonas denitrificans
OTU260.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Enhydrobacter; s__unclassified
OTU271.000.001.001.003.001.002.001.002.001.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU2887.00145.0093.00190.00115.00210.00197.00126.0097.00138.0041.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus lactis
OTU291.000.000.000.002.001.000.001.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU300.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__johnsonii
OTU311.000.000.000.002.001.000.000.001.002.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU321.002.003.001.003.004.002.002.000.001.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU331.004.003.0010.004.009.007.002.008.009.002.00d__Bacteria; p__Firmicutes; c__Negativicutes; o__Selenomonadales; f__Veillonellaceae; g__Veillonella; s__unclassified
OTU343.004.007.0010.0012.0012.0014.008.0010.0011.004.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU3510.009.009.0016.008.0013.0017.0012.0011.007.004.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__unclassified
OTU3642.0041.0037.0062.0028.0057.0057.0035.0054.0041.0014.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Erwinia; s__unclassified
OTU3714.0020.0024.0019.0078.0032.0014.0020.0019.0023.005.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__fragi
OTU382.005.006.005.0013.009.009.006.009.005.002.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Pantoea; s__unclassified
OTU399.0015.0020.0028.0064.0039.0028.0025.0025.0033.0010.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Pectobacterium; s__Pectobacterium carotovorum
OTU401.005.0023.0017.0025.0020.007.0010.0010.0023.003.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__viridiflava
OTU4121.0022.0027.0030.0034.0044.0034.0029.0013.0025.0013.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU4217.0045.0020.0055.00123.0054.0047.0032.0010.0050.008.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Leuconostocaceae; g__Leuconostoc; s__Leuconostoc lactis
OTU432.003.004.000.001.002.002.002.004.003.001.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Burkholderiales_incertae_sedis; g__Sphaerotilus; s__unclassified
OTU443.008.002.006.003.007.004.001.006.002.001.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Janthinobacterium; s__lividum
OTU450.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU460.000.000.000.000.001.000.001.001.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Hydrogenophaga; s__unclassified
OTU475.0013.007.0011.005.0015.0010.0014.0016.0012.006.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__unclassified
OTU4822.0027.0015.0028.0015.0049.0029.0031.008.0024.004.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Xanthomonas; s__campestris
OTU4914.0011.008.0016.0019.0017.0015.0020.009.0025.001.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__Streptococcus parauberis
OTU501.004.004.001.003.004.002.006.002.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Escherichia/Shigella; s__unclassified
OTU511.000.000.000.000.000.000.0012.003.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Comamonas; s__unclassified
OTU520.000.000.002.000.002.001.001.002.001.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Leuconostocaceae; g__Weissella; s__Weissella confusa
OTU530.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Pseudoxanthomonas; s__taiwanensis
OTU540.003.001.002.003.004.002.000.009.001.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU550.000.000.000.001.000.000.001.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Raoultella; s__unclassified
OTU560.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Duganella; s__unclassified
OTU570.000.000.000.000.001.001.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Rhodocyclales; f__Rhodocyclaceae; g__Zoogloea; s__Zoogloea ramigera
OTU580.001.000.001.000.000.000.001.001.002.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Aeromonadales; f__Aeromonadaceae; g__Tolumonas; s__Tolumonas auensis
OTU591.002.000.000.005.002.004.004.002.005.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Carnobacteriaceae; g__Trichococcus; s__unclassified
OTU600.000.0012.004.008.000.001.002.008.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Erwinia; s__rhapontici
OTU610.001.001.001.000.000.002.001.002.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__Vogesella; s__unclassified
OTU6257.0083.0078.0088.0041.0098.0085.0071.0035.0052.0017.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU630.001.000.002.002.000.002.000.001.000.001.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__Lactobacillus fermentum
OTU641.001.001.005.001.004.005.003.003.003.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Aeromonadales; f__Aeromonadaceae; g__Aeromonas; s__hydrophila
OTU650.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Firmicutes; c__Negativicutes; o__Selenomonadales; f__Veillonellaceae; g__unclassified; s__unclassified
OTU660.000.000.001.003.002.002.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__unclassified; s__unclassified
OTU670.000.000.001.000.002.001.002.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__unclassified
OTU680.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Roseateles; s__depolymerans
OTU691.000.000.002.002.000.001.001.002.000.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU700.001.004.002.002.003.000.002.001.002.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Klebsiella; s__oxytoca
OTU712.001.000.000.004.001.001.005.001.002.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Duganella; s__unclassified
OTU720.000.001.001.002.000.005.004.002.001.001.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Enterococcaceae; g__Vagococcus; s__Vagococcus fluvialis
OTU730.000.001.000.002.002.000.001.001.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Acidovorax; s__unclassified
OTU741.001.002.002.001.002.002.003.002.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Duganella; s__unclassified
OTU750.000.000.000.000.000.001.000.001.000.001.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU760.000.000.001.002.002.001.000.001.000.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Aeromonadales; f__Aeromonadaceae; g__Tolumonas; s__Tolumonas auensis
OTU771.000.000.001.000.001.000.000.001.000.001.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Burkholderiaceae; g__Burkholderia; s__unclassified
OTU781.003.001.002.002.001.002.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Comamonas; s__unclassified
OTU791.000.002.000.001.001.001.004.001.001.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU801.005.002.002.005.002.003.003.001.004.001.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Bacillales_Incertae Sedis XII; g__Exiguobacterium; s__unclassified
OTU810.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU821.002.000.001.002.003.001.003.002.004.001.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__Streptococcus ferus
OTU831.000.001.000.001.000.000.000.001.001.001.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__unclassified; s__unclassified
OTU841.000.000.002.001.004.001.004.001.002.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Delftia; s__unclassified
OTU850.001.000.002.000.000.001.000.001.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Massilia; s__jejuensis
OTU860.000.000.000.000.000.000.000.002.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Schlegelella; s__unclassified
OTU870.000.000.000.002.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Stenotrophomonas; s__Stenotrophomonas chelatiphaga
OTU880.001.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__Vitreoscilla; s__unclassified
OTU890.001.000.000.000.000.000.001.001.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__unclassified; s__unclassified
OTU900.000.003.001.001.000.001.004.001.000.001.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Comamonas; s__unclassified
OTU912.000.001.000.004.000.002.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Rahnella; s__aquatilis
OTU920.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Thermoleophilia; o__Solirubrobacterales; f__unclassified; g__unclassified; s__unclassified
OTU930.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp6; o__Gp6; f__Gp6; g__Gp6; s__unclassified
OTU940.000.001.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__Acinetobacter rudis
OTU950.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU960.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Nitrospirae; c__Nitrospira; o__Nitrospirales; f__0319-6A21; g__unclassified; s__unclassified
OTU970.000.002.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Bdellovibrionales; f__Bacteriovoracaceae; g__Bacteriovorax; s__Bacteriovorax stolpii
OTU980.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Nitrospirae; c__Nitrospira; o__Nitrospirales; f__0319-6A21; g__unclassified; s__unclassified
OTU990.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Escherichia; s__hermannii
OTU1000.000.001.001.000.001.001.001.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU10145.0060.0046.0063.0037.0078.0072.0038.005.0031.0014.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU1025.004.003.005.007.003.002.0027.000.006.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__johnsonii
OTU1032.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU1040.000.001.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Acidovorax; s__unclassified
OTU1050.000.001.000.000.000.001.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp7; o__Gp7; f__Gp7; g__Gp7; s__unclassified
OTU1060.000.001.000.000.001.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Pseudomonas; s__syringae
OTU1070.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Nitrospirae; c__Nitrospira; o__Nitrospirales; f__0319-6A21; g__unclassified; s__unclassified
OTU1080.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp1; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU1090.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU1100.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU1110.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU1120.001.000.002.001.000.004.001.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__Acinetobacter beijerinckii
OTU1130.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Latescibacteria; c__Latescibacteria_genera_incertae_sedis; o__Latescibacteria_genera_incertae_sedis; f__Latescibacteria_genera_incertae_sedis; g__Latescibacteria_genera_incertae_sedis; s__unclassified
OTU1140.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp17; o__Gp17; f__Gp17; g__Gp17; s__unclassified
OTU1150.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU1160.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU1170.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp17; o__Gp17; f__Gp17; g__Gp17; s__unclassified
OTU1182.000.000.002.001.002.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU1190.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Gemmatimonadetes; c__Gemm-1; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU1200.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Negativicutes; o__Selenomonadales; f__Veillonellaceae; g__Veillonella; s__unclassified
OTU1210.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU1220.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__unclassified; s__unclassified
OTU1230.000.001.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__plantarum
OTU1240.000.001.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Burkholderiales_incertae_sedis; g__Aquabacterium; s__unclassified
OTU1253.000.001.001.001.001.001.001.000.000.001.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Variovorax; s__paradoxus
OTU1260.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU1270.000.005.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__viridiflava
OTU1280.000.001.000.002.000.001.001.000.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__Vogesella; s__unclassified
OTU1290.000.001.001.000.000.000.001.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU1301.002.002.004.003.000.001.002.000.004.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__Aquitalea; s__magnusonii
OTU1310.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU1320.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Planococcaceae; g__Planococcaceae_incertae_sedis; s__unclassified
OTU1330.000.001.002.000.000.000.001.000.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Undibacterium; s__unclassified
OTU1340.002.004.004.001.003.002.002.000.005.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__Vogesella; s__unclassified
OTU1358.0017.0011.0030.0052.0024.0023.0025.000.0017.004.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU1360.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Desulfovibrionales; f__Desulfovibrionaceae; g__Desulfovibrio; s__Desulfovibrio desulfuricans
OTU1371.000.001.005.000.001.004.002.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__viridiflava
OTU1380.000.001.001.001.000.002.003.000.001.002.00d__Bacteria; p__Firmicutes; c__Negativicutes; o__Selenomonadales; f__Veillonellaceae; g__Veillonella; s__unclassified
OTU1390.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__freundii
OTU1400.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__viridiflava
OTU1410.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU1420.000.001.000.000.002.001.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Negativicutes; o__Selenomonadales; f__Veillonellaceae; g__Selenomonas; s__Selenomonas lacticifex
OTU1431.000.001.000.000.000.000.001.000.000.001.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Duganella; s__unclassified
OTU1441.001.002.001.002.002.002.001.000.001.002.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__unclassified; s__unclassified
OTU1450.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp7; o__Gp7; f__Gp7; g__Gp7; s__unclassified
OTU1462.001.001.000.002.001.002.001.000.001.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Aeromonadales; f__Aeromonadaceae; g__Aeromonas; s__unclassified
OTU1470.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__unclassified; s__unclassified
OTU1480.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU1490.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU1500.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU1511.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Myxococcales; f__Cystobacteraceae; g__Anaeromyxobacter; s__unclassified
OTU1520.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Latescibacteria; c__Latescibacteria_genera_incertae_sedis; o__Latescibacteria_genera_incertae_sedis; f__Latescibacteria_genera_incertae_sedis; g__Latescibacteria_genera_incertae_sedis; s__unclassified
OTU1530.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhodospirillales; f__Rhodospirillaceae; g__unclassified; s__unclassified
OTU1540.000.000.001.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU1550.000.000.000.0011.001.001.002.000.003.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Carnobacteriaceae; g__Carnobacterium; s__viridans
OTU1560.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU1570.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__brevis
OTU1580.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus raffinolactis
OTU1590.000.000.006.008.001.000.000.000.004.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU1600.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU1610.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU1626.0017.000.0015.0033.0011.0015.0016.000.005.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU1630.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU1640.001.000.001.0021.000.002.002.000.001.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Leuconostocaceae; g__Leuconostoc; s__unclassified
OTU1650.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU1660.000.000.003.002.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Psychrobacter; s__unclassified
OTU1671.003.001.003.006.002.001.003.000.003.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU1680.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Enterobacter; s__hormaechei
OTU1696.006.000.0011.003.009.0010.007.000.004.002.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Klebsiella; s__unclassified
OTU1700.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Thiotrichales; f__Piscirickettsiaceae; g__unclassified; s__unclassified
OTU1710.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU1720.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU1730.000.000.000.001.001.000.001.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Vibrionales; f__Vibrionaceae; g__Vibrio; s__unclassified
OTU1740.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__viridiflava
OTU1750.000.000.000.002.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Burkholderiaceae; g__Ralstonia; s__unclassified
OTU1760.000.000.001.001.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU1770.000.000.000.002.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Pectobacterium; s__Pectobacterium carotovorum
OTU1780.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__veronii
OTU1792.008.001.007.007.009.007.008.000.003.003.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__viridiflava
OTU1800.000.000.000.002.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__Lactobacillus nenjiangensis
OTU1810.002.000.006.0015.003.003.001.000.004.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU1820.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__unclassified; s__unclassified
OTU1830.000.000.000.001.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Erwinia; s__unclassified
OTU1840.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus raffinolactis
OTU1850.001.000.001.002.001.000.004.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Alteromonadales; f__Shewanellaceae; g__Shewanella; s__unclassified
OTU1860.000.000.001.001.002.001.001.000.000.004.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU1870.000.000.002.001.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Rhodocyclales; f__Rhodocyclaceae; g__Dechloromonas; s__unclassified
OTU1880.000.000.000.001.000.001.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Stenotrophomonas; s__unclassified
OTU1890.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Klebsiella; s__unclassified
OTU1900.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Aeromonadales; f__Aeromonadaceae; g__Tolumonas; s__Tolumonas auensis
OTU1910.001.000.004.009.003.001.001.000.006.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU1920.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU1931.000.000.000.001.000.001.001.000.000.001.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Curvibacter; s__unclassified
OTU1940.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU1950.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp17; o__Gp17; f__Gp17; g__Gp17; s__unclassified
OTU1960.000.000.000.001.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Rudaea; s__Rudaea cellulosilytica
OTU1970.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Ellin6067; f__unclassified; g__unclassified; s__unclassified
OTU1980.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU1990.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU2000.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__viridiflava
OTU2010.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Leuconostocaceae; g__Leuconostoc; s__unclassified
OTU2021.001.000.001.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Methylophilales; f__Methylophilaceae; g__Methylophilus; s__unclassified
OTU2030.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU2040.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU2050.000.000.000.001.002.002.000.000.000.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU2060.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__unclassified
OTU2070.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Negativicutes; o__Selenomonadales; f__Veillonellaceae; g__unclassified; s__unclassified
OTU2080.000.000.002.001.001.002.002.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU2090.000.000.000.002.000.001.004.000.004.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Serratia; s__unclassified
OTU2101.003.001.003.001.003.005.003.000.002.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Klebsiella; s__unclassified
OTU2111.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Psychrobacter; s__unclassified
OTU2120.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__SC-I-84; f__unclassified; g__unclassified; s__unclassified
OTU2135.004.000.003.001.002.005.006.000.002.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Serratia; s__unclassified
OTU2140.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Vibrionales; f__Vibrionaceae; g__Vibrio; s__orientalis
OTU2150.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU2160.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Bacillaceae 1; g__Bacillus; s__unclassified
OTU2173.000.000.000.001.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__unclassified; s__unclassified
OTU2180.000.001.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU2190.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU2207.000.001.000.000.000.000.000.000.001.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Staphylococcaceae; g__Staphylococcus; s__aureus
OTU2210.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Planococcaceae; g__Planococcus; s__unclassified
OTU2220.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU2230.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__freundii
OTU2240.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp17; o__Gp17; f__Gp17; g__Gp17; s__unclassified
OTU2251.000.000.001.000.000.000.002.000.000.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Enhydrobacter; s__unclassified
OTU2260.000.000.002.000.000.000.000.000.001.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__unclassified
OTU2270.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Comamonas; s__unclassified
OTU2280.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Erwinia; s__unclassified
OTU2290.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Chromatiales; f__Chromatiaceae; g__Rheinheimera; s__Rheinheimera soli
OTU2300.000.000.002.000.001.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Psychrobacter; s__unclassified
OTU2310.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__viridiflava
OTU2320.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Carnobacteriaceae; g__Carnobacterium; s__viridans
OTU2330.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU2341.001.000.001.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Chromatiales; f__Chromatiaceae; g__Rheinheimera; s__unclassified
OTU2350.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus raffinolactis
OTU2360.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__HOC36; f__unclassified; g__unclassified; s__unclassified
OTU2370.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU2380.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__unclassified
OTU2391.001.000.001.000.000.001.003.000.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__Vogesella; s__unclassified
OTU2400.000.000.002.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Noviherbaspirillum; s__unclassified
OTU2410.002.001.001.000.001.000.000.000.003.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__fragi
OTU2421.000.000.002.000.001.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Massilia; s__unclassified
OTU2431.000.000.001.000.001.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Comamonas; s__unclassified
OTU2440.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Myxococcales; f__Polyangiaceae; g__unclassified; s__unclassified
OTU2450.001.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Raoultella; s__unclassified
OTU2460.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU2473.008.000.007.000.004.004.001.000.004.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Enterobacter; s__asburiae
OTU2480.001.000.001.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU2490.001.000.002.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Psychrobacter; s__Psychrobacter maritimus
OTU2500.000.000.001.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Negativicutes; o__Selenomonadales; f__Acidaminococcaceae; g__unclassified; s__unclassified
OTU2510.000.000.001.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU2520.000.000.003.000.002.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Massilia; s__unclassified
OTU2530.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Naxibacter; s__unclassified
OTU2540.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus raffinolactis
OTU2550.000.000.001.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Planococcaceae; g__Kurthia; s__unclassified
OTU2560.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU2570.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Sinobacteraceae; g__unclassified; s__unclassified
OTU2580.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Buchnera; s__Buchnera aphidicola
OTU2590.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Thermoleophilia; o__Solirubrobacterales; f__unclassified; g__unclassified; s__unclassified
OTU2600.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Cellvibrio; s__unclassified
OTU2610.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU2620.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Alkanindiges; s__unclassified
OTU2630.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus raffinolactis
OTU2640.000.000.002.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Rhodocyclales; f__Rhodocyclaceae; g__Uliginosibacterium; s__unclassified
OTU2650.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU2660.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__SC-I-84; f__unclassified; g__unclassified; s__unclassified
OTU2670.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU2680.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Burkholderiales_incertae_sedis; g__Piscinibacter; s__unclassified
OTU2690.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__unclassified; s__unclassified
OTU2702.001.000.001.000.000.000.000.000.003.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Burkholderiaceae; g__Ralstonia; s__Ralstonia insidiosa
OTU2713.003.000.004.001.008.005.004.000.006.002.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Enterobacter; s__unclassified
OTU2720.000.000.001.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Undibacterium; s__unclassified
OTU2730.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU2740.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__fragi
OTU2750.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Serratia; s__unclassified
OTU2760.000.000.001.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Janthinobacterium; s__unclassified
OTU2770.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp25; o__Gp25; f__Gp25; g__Gp25; s__unclassified
OTU2780.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU2790.000.000.000.001.001.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Paenibacillaceae 1; g__Saccharibacillus; s__unclassified
OTU2800.000.000.001.003.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Paenibacillaceae 1; g__Paenibacillus; s__unclassified
OTU2811.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Myxococcales; f__Haliangiaceae; g__unclassified; s__unclassified
OTU2820.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Gaiellales; f__Gaiellaceae; g__Gaiella; s__unclassified
OTU2830.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Myxococcales; f__unclassified; g__unclassified; s__unclassified
OTU2840.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Panacagrimonas; s__Panacagrimonas perspica
OTU2850.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp6; o__Gp6; f__Gp6; g__Gp6; s__unclassified
OTU2860.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Myxococcales; f__Haliangiaceae; g__unclassified; s__unclassified
OTU2870.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU2880.000.000.000.000.001.000.000.000.002.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__guillouiae
OTU2890.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp17; o__Gp17; f__Gp17; g__Gp17; s__unclassified
OTU2900.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Bacillaceae 1; g__Bacillus; s__unclassified
OTU2910.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Enterococcaceae; g__unclassified; s__unclassified
OTU2921.000.000.000.000.001.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU2930.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp6; o__Gp6; f__Gp6; g__Gp6; s__unclassified
OTU2940.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Latescibacteria; c__Latescibacteria_genera_incertae_sedis; o__Latescibacteria_genera_incertae_sedis; f__Latescibacteria_genera_incertae_sedis; g__Latescibacteria_genera_incertae_sedis; s__unclassified
OTU2950.000.000.000.000.001.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__guillouiae
OTU2960.000.001.000.000.000.000.002.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU2970.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Klebsiella; s__unclassified
OTU2980.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU2990.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU3000.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__unclassified
OTU3010.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Chloroflexi; c__Ellin6529; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU3020.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Rhodocyclales; f__Rhodocyclaceae; g__Zoogloea; s__Zoogloea ramigera
OTU3031.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__unclassified; g__unclassified; s__unclassified
OTU3040.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__Acinetobacter seohaensis
OTU3050.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU3060.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Bdellovibrionales; f__Bacteriovoracaceae; g__Peredibacter; s__unclassified
OTU3070.000.000.000.000.000.001.000.000.001.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp6; o__Gp6; f__Gp6; g__Gp6; s__unclassified
OTU3080.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp17; o__Gp17; f__Gp17; g__Gp17; s__unclassified
OTU3090.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp16; o__Gp16; f__Gp16; g__Gp16; s__unclassified
OTU3100.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp6; o__Gp6; f__Gp6; g__Gp6; s__unclassified
OTU3110.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__GN04; c__MSB-5A5; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU3120.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Alcaligenaceae; g__Achromobacter; s__unclassified
OTU3130.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Herminiimonas; s__fonticola
OTU3140.000.000.000.000.001.001.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Massilia; s__timonae
OTU3150.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Enterobacter; s__unclassified
OTU3160.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__fragi
OTU3170.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus raffinolactis
OTU3180.000.000.000.000.001.000.001.000.000.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU3190.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU3200.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__fragi
OTU3210.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU3220.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__unclassified
OTU3230.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU3240.000.000.000.000.001.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Pseudorhodoferax; s__unclassified
OTU3250.000.000.000.000.001.002.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Raoultella; s__terrigena
OTU3260.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Leuconostocaceae; g__Leuconostoc; s__unclassified
OTU3270.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Negativicutes; o__Selenomonadales; f__unclassified; g__unclassified; s__unclassified
OTU3280.000.000.000.000.002.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__unclassified
OTU3290.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Carnobacteriaceae; g__Desemzia; s__unclassified
OTU3301.0010.000.000.000.003.006.008.000.004.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__fragi
OTU3310.003.000.000.000.001.003.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU3320.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__veronii
OTU3330.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU3340.001.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__Lactobacillus concavus
OTU3350.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Herbaspirillum; s__rubrisubalbicans
OTU3360.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp17; o__Gp17; f__Gp17; g__Gp17; s__unclassified
OTU3370.001.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__MBNT15; f__unclassified; g__unclassified; s__unclassified
OTU3380.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU3390.000.000.000.000.002.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus chungangensis
OTU3400.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Listeriaceae; g__Brochothrix; s__unclassified
OTU3411.001.000.000.000.001.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Acidovorax; s__unclassified
OTU3421.004.000.000.000.002.000.002.000.003.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU3430.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pasteurellales; f__Pasteurellaceae; g__Actinobacillus; s__unclassified
OTU3440.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Methylophilales; f__Methylophilaceae; g__Methylophilus; s__unclassified
OTU3450.000.000.000.000.002.000.000.000.000.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Providencia; s__unclassified
OTU3460.000.000.000.000.001.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__unclassified
OTU3470.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU3480.001.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__unclassified
OTU3490.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU3500.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__fragi
OTU3510.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__johnsonii
OTU3520.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Buchnera; s__unclassified
OTU3530.001.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Rhodocyclales; f__Rhodocyclaceae; g__Zoogloea; s__unclassified
OTU3540.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__unclassified
OTU3550.000.000.000.000.001.000.003.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__Pseudomonas chlororaphis
OTU3560.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cloacimonetes; c__Candidatus Cloacamonas; o__Candidatus Cloacamonas; f__Candidatus Cloacamonas; g__Candidatus Cloacamonas; s__unclassified
OTU3570.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU3580.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Enhydrobacter; s__unclassified
OTU3590.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU3600.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU3610.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Verrucomicrobia; c__Subdivision3; o__Subdivision3_genera_incertae_sedis; f__Subdivision3_genera_incertae_sedis; g__Subdivision3_genera_incertae_sedis; s__unclassified
OTU3620.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Bacteroidetes; c__Saprospirae; o__Saprospirales; f__Chitinophagaceae; g__unclassified; s__unclassified
OTU3631.000.000.001.004.005.001.003.002.002.001.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Cloacibacterium; s__unclassified
OTU3643.001.002.000.000.001.002.002.002.002.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__succinicans
OTU3650.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU3660.001.001.004.004.002.000.002.003.004.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU3670.001.000.000.000.001.000.001.001.002.001.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU3680.001.001.001.000.000.003.000.002.000.001.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Pedobacter; s__unclassified
OTU3690.001.001.003.003.001.001.000.002.003.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__unclassified; s__unclassified
OTU3700.000.001.001.002.002.000.002.001.001.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Sphingobacterium; s__faecium
OTU3710.000.001.000.000.000.000.000.001.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU3720.000.000.002.001.000.000.000.001.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Epilithonimonas; s__unclassified
OTU3732.002.002.000.001.001.002.004.002.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Prevotellaceae; g__Prevotella; s__Prevotella paludivivens
OTU3740.000.000.001.001.000.000.000.001.001.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Pedobacter; s__unclassified
OTU3753.001.005.003.003.007.003.004.005.008.002.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__Chryseobacterium hominis
OTU3760.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Sphingobacterium; s__unclassified
OTU3770.000.001.001.000.001.001.001.001.001.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Hymenobacter; s__unclassified
OTU3780.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__unclassified; g__unclassified; s__unclassified
OTU3792.001.001.001.001.000.000.002.001.000.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Hymenobacter; s__Hymenobacter ginsengisoli
OTU3801.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Latescibacteria; c__Latescibacteria_genera_incertae_sedis; o__Latescibacteria_genera_incertae_sedis; f__Latescibacteria_genera_incertae_sedis; g__Latescibacteria_genera_incertae_sedis; s__unclassified
OTU3810.000.000.000.000.000.000.001.000.004.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Salmonella; s__subterranea
OTU3820.001.000.000.000.000.002.000.000.002.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Enterobacter; s__ludwigii
OTU3830.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU3840.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU3850.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Stenotrophomonas; s__unclassified
OTU3860.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Klebsiella; s__unclassified
OTU3870.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__unclassified; s__unclassified
OTU3880.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus chungangensis
OTU3890.000.000.000.000.000.001.000.000.002.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__unclassified
OTU3900.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU3910.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__viridiflava
OTU3920.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__Formivibrio; s__citricus
OTU3931.000.000.000.000.000.000.002.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU3940.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU3950.000.000.000.000.000.000.001.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Pectobacterium; s__unclassified
OTU3960.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU3970.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU3984.001.000.000.000.000.007.007.000.002.004.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU3990.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__viridiflava
OTU4000.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU4010.000.000.000.000.000.002.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Stenotrophomonas; s__unclassified
OTU4020.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Klebsiella; s__unclassified
OTU4030.000.000.000.000.000.000.001.000.000.001.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU4040.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU4050.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU4060.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU4070.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Verrucomicrobia; c__Subdivision3; o__Subdivision3_genera_incertae_sedis; f__Subdivision3_genera_incertae_sedis; g__Subdivision3_genera_incertae_sedis; s__unclassified
OTU4080.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Alcaligenaceae; g__Alcaligenes; s__faecalis
OTU4090.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU4100.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__unclassified; g__unclassified; s__unclassified
OTU4110.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp6; o__Gp6; f__Gp6; g__Gp6; s__unclassified
OTU4120.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__BPC076; f__unclassified; g__unclassified; s__unclassified
OTU4130.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__veronii
OTU4140.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp17; o__Gp17; f__Gp17; g__Gp17; s__unclassified
OTU4150.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp17; o__Gp17; f__Gp17; g__Gp17; s__unclassified
OTU4160.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU4170.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU4180.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU4190.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__unclassified
OTU4200.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU4210.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Rhodocyclales; f__Rhodocyclaceae; g__Azospira; s__Azospira oryzae
OTU4220.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Verrucomicrobia; c__Verrucomicrobiae; o__Verrucomicrobiales; f__Verrucomicrobiaceae; g__Luteolibacter; s__unclassified
OTU4230.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU4240.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__unclassified
OTU4250.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__fragi
OTU4260.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Thermoleophilia; o__Solirubrobacterales; f__Conexibacteraceae; g__unclassified; s__unclassified
OTU4270.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Buchnera; s__unclassified
OTU4280.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Ramlibacter; s__unclassified
OTU4290.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU4300.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU4310.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU4320.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Leuconostocaceae; g__Weissella; s__ghanensis
OTU4330.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus raffinolactis
OTU4340.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU4350.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Arenimonas; s__unclassified
OTU4360.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Xanthomonas; s__campestris
OTU4370.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Pectobacterium; s__unclassified
OTU4380.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Negativicutes; o__Selenomonadales; f__Acidaminococcaceae; g__Succinispira; s__Succinispira mobilis
OTU4390.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU4400.000.000.000.000.000.001.000.000.000.002.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU4410.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Aerococcaceae; g__Aerococcus; s__unclassified
OTU4420.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU4430.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Lactobacillaceae; g__Lactobacillus; s__unclassified
OTU4440.000.000.000.000.000.001.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Rhodocyclales; f__Rhodocyclaceae; g__Zoogloea; s__unclassified
OTU4450.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU4460.000.000.000.000.000.001.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU4470.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Buchnera; s__Buchnera aphidicola
OTU4480.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Micrococcaceae; g__unclassified; s__unclassified
OTU4490.001.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Hymenobacter; s__unclassified
OTU4505.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__guillouiae
OTU4511.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__MBNT15; f__unclassified; g__unclassified; s__unclassified
OTU4521.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp6; o__Gp6; f__Gp6; g__Gp6; s__unclassified
OTU4531.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU4541.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__FCPU426; c__unclassified; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU4551.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Desulfuromonadales; f__Geobacteraceae; g__Geobacter; s__unclassified
OTU4561.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp17; o__Gp17; f__Gp17; g__Gp17; s__unclassified
OTU4570.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Gaiellales; f__Gaiellaceae; g__Gaiella; s__unclassified
OTU4580.001.000.000.000.000.000.001.000.000.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Lysobacter; s__unclassified
OTU4590.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU4600.000.000.000.000.000.000.001.000.000.002.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU4610.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Chlamydiae; c__Chlamydiia; o__Chlamydiales; f__Parachlamydiaceae; g__Candidatus Protochlamydia; s__unclassified
OTU4620.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__unclassified; s__unclassified
OTU4630.000.000.000.000.000.000.001.000.000.002.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU4640.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__Vogesella; s__unclassified
OTU4650.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU4660.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__unclassified
OTU4670.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__unclassified
OTU4680.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Chlamydiae; c__Chlamydiia; o__Chlamydiales; f__unclassified; g__unclassified; s__unclassified
OTU4690.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp4; o__Gp4; f__Gp4; g__Gp4; s__unclassified
OTU4700.000.001.000.000.000.002.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Soonwooa; s__Soonwooa buanensis
OTU4710.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU4720.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Myroides; s__odoratimimus
OTU4730.001.001.001.002.001.000.003.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Dyadobacter; s__unclassified
OTU4740.000.001.001.000.000.000.000.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU4750.001.001.001.000.002.001.000.000.003.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU4760.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp13; o__Gp13; f__Gp13; g__Gp13; s__unclassified
OTU4770.000.001.002.002.003.005.005.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Pedobacter; s__unclassified
OTU4780.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Undibacterium; s__Undibacterium pigrum
OTU4790.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Enterobacter; s__hormaechei
OTU4800.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Polaromonas; s__unclassified
OTU4810.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Rhodocyclales; f__Rhodocyclaceae; g__unclassified; s__unclassified
OTU4821.001.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Stenotrophomonas; s__acidaminiphila
OTU4830.001.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU4840.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__TM6; c__SJA-4; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU4850.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Comamonas; s__Comamonas denitrificans
OTU4860.001.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Janthinobacterium; s__unclassified
OTU4870.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU4880.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU4890.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU4900.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus raffinolactis
OTU4910.001.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Chromatiales; f__Chromatiaceae; g__Rheinheimera; s__unclassified
OTU4920.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Chlamydiae; c__Chlamydiia; o__Chlamydiales; f__Parachlamydiaceae; g__Candidatus Protochlamydia; s__unclassified
OTU4930.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Alteromonadales; f__Shewanellaceae; g__Shewanella; s__Shewanella baltica
OTU4940.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU4950.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Enterobacter; s__hormaechei
OTU4960.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU4970.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__unclassified
OTU4980.001.000.001.000.000.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Sphingobacterium; s__multivorum
OTU4991.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU5001.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU5012.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Telluria; s__mixta
OTU5021.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Tepidicella; s__unclassified
OTU5031.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__freundii
OTU5041.000.000.000.000.000.000.0013.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Alteromonadales; f__Shewanellaceae; g__Shewanella; s__unclassified
OTU5051.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU5061.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU5071.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Bacillales_Incertae Sedis XII; g__Exiguobacterium; s__unclassified
OTU5081.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU5091.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Janthinobacterium; s__lividum
OTU5101.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__unclassified
OTU5111.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Brachymonas; s__chironomi
OTU5121.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU5131.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU5141.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU5151.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__Vogesella; s__unclassified
OTU5161.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Variovorax; s__paradoxus
OTU5171.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Acidovorax; s__unclassified
OTU5182.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Bdellovibrionales; f__Bacteriovoracaceae; g__Peredibacter; s__unclassified
OTU5191.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp6; o__Gp6; f__Gp6; g__Gp6; s__unclassified
OTU5200.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp4; o__Gp4; f__Gp4; g__Gp4; s__unclassified
OTU5210.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Verrucomicrobia; c__Subdivision3; o__Subdivision3_genera_incertae_sedis; f__Subdivision3_genera_incertae_sedis; g__Subdivision3_genera_incertae_sedis; s__unclassified
OTU5220.001.000.001.001.000.000.000.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU5230.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU5240.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Rikenellaceae; g__Alistipes; s__unclassified
OTU5251.000.000.000.001.000.000.000.000.000.001.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Bacteroidaceae; g__Bacteroides; s__Bacteroides graminisolvens
OTU5260.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Sphingobacterium; s__unclassified
OTU5270.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Myroides; s__odoratimimus
OTU5281.001.000.000.001.000.001.000.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Hymenobacter; s__unclassified
OTU5290.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Sphingobacterium; s__faecium
OTU5302.003.000.001.001.001.004.002.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU5310.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Rikenellaceae; g__Alistipes; s__unclassified
OTU5320.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Thermoleophilia; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU5330.000.000.000.001.001.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Hymenobacter; s__Hymenobacter ginsengisoli
OTU5340.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__unclassified; g__unclassified; s__unclassified
OTU5350.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Promicromonosporaceae; g__unclassified; s__unclassified
OTU5360.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__unclassified; g__unclassified; s__unclassified
OTU5370.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU5380.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU5390.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Enhydrobacter; s__unclassified
OTU5400.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU5410.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidetes_incertae_sedis; o__Ohtaekwangia; f__Ohtaekwangia; g__Ohtaekwangia; s__unclassified
OTU5420.000.001.000.000.000.000.000.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Hymenobacter; s__Hymenobacter gelipurpurascens
OTU5430.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU5442.002.000.004.000.006.003.001.000.002.001.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU5452.000.000.001.000.001.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Pedobacter; s__unclassified
OTU5460.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Myxococcales; f__Haliangiaceae; g__unclassified; s__unclassified
OTU5470.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU5480.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Porphyromonadaceae; g__Dysgonomonas; s__unclassified
OTU5490.000.000.002.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Pedobacter; s__unclassified
OTU5500.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU5510.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Myroides; s__Myroides odoratus
OTU5520.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU5530.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__succinicans
OTU5540.001.000.001.000.001.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__succinicans
OTU5550.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__GOUTA4; c__unclassified; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU5560.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__Flavobacterium flevense
OTU5570.000.000.001.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Porphyromonadaceae; g__Dysgonomonas; s__unclassified
OTU5580.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Chitinophagaceae; g__unclassified; s__unclassified
OTU5590.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU5600.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU5611.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Verrucomicrobia; c__Subdivision3; o__Subdivision3_genera_incertae_sedis; f__Subdivision3_genera_incertae_sedis; g__Subdivision3_genera_incertae_sedis; s__unclassified
OTU5621.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Thermoleophilia; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU5631.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Verrucomicrobia; c__Subdivision3; o__Subdivision3_genera_incertae_sedis; f__Subdivision3_genera_incertae_sedis; g__Subdivision3_genera_incertae_sedis; s__unclassified
OTU5641.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU5651.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Planctomycetes; c__C6; o__MVS-107; f__unclassified; g__unclassified; s__unclassified
OTU5661.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU5671.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__unclassified
OTU5680.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp4; o__Gp4; f__Gp4; g__Gp4; s__unclassified
OTU5690.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU5700.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__fragi
OTU5710.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Klebsiella; s__unclassified
OTU5720.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Rhodocyclales; f__Rhodocyclaceae; g__Azovibrio; s__Azovibrio restrictus
OTU5730.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Xanthomonas; s__campestris
OTU5740.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__unclassified; s__unclassified
OTU5750.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU5760.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Leuconostocaceae; g__Leuconostoc; s__unclassified
OTU5770.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__unclassified; s__unclassified
OTU5780.000.000.000.000.000.000.002.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Polaromonas; s__unclassified
OTU5790.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU5800.000.000.000.000.000.000.002.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Burkholderiales_incertae_sedis; g__Sphaerotilus; s__unclassified
OTU5810.000.000.000.000.000.000.002.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Duganella; s__unclassified
OTU5820.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus plantarum
OTU5830.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Bacillaceae 1; g__Bacillus; s__unclassified
OTU5840.000.000.000.000.000.000.004.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Alteromonadales; f__Shewanellaceae; g__Shewanella; s__Shewanella seohaensis
OTU5850.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU5860.000.000.000.000.000.000.003.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__alcaligenes
OTU5870.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Psychrobacter; s__unclassified
OTU5880.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Bacillales; f__Bacillaceae 1; g__Bacillus; s__unclassified
OTU5890.000.000.000.000.000.000.003.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__stutzeri
OTU5900.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Serratia; s__unclassified
OTU5910.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU5920.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__unclassified; s__unclassified
OTU5930.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU5940.000.000.000.000.000.000.003.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__pseudoalcaligenes
OTU5950.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU5960.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__Lactococcus raffinolactis
OTU5970.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Intrasporangiaceae; g__Janibacter; s__unclassified
OTU5980.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__unclassified; s__unclassified
OTU5990.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__unclassified
OTU6000.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU6010.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU6020.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__unclassified
OTU6030.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Carnobacteriaceae; g__Trichococcus; s__unclassified
OTU6040.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Comamonas; s__unclassified
OTU6050.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Pelomonas; s__unclassified
OTU6060.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Herminiimonas; s__fonticola
OTU6070.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__unclassified; s__unclassified
OTU6080.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU6090.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU6100.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Aeromonadales; f__Aeromonadaceae; g__unclassified; s__unclassified
OTU6110.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Lachnospiraceae; g__unclassified; s__unclassified
OTU6120.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Sva0725; o__Sva0725; f__unclassified; g__unclassified; s__unclassified
OTU6130.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6140.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__unclassified; s__unclassified
OTU6150.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Flectobacillus; s__unclassified
OTU6160.000.000.000.000.001.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Porphyromonadaceae; g__Paludibacter; s__Paludibacter propionicigenes
OTU6170.000.000.000.000.001.000.001.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6180.000.000.000.000.003.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU6191.000.000.000.000.002.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Pedobacter; s__unclassified
OTU6200.001.000.000.000.001.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6210.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Sphingobacterium; s__unclassified
OTU6220.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU6230.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6240.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU6250.001.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__succinicans
OTU6260.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__Flavobacterium cheniae
OTU6270.000.000.000.000.001.001.000.000.001.001.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU6280.000.000.000.000.001.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Dyadobacter; s__unclassified
OTU6290.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Pedobacter; s__unclassified
OTU6300.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Alteromonadales; f__Shewanellaceae; g__Shewanella; s__unclassified
OTU6310.000.004.000.001.000.001.000.002.001.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Micrococcaceae; g__Arthrobacter; s__psychrolactophilus
OTU6320.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Gemmatimonadetes; c__Gemmatimonadetes; o__Gemmatimonadales; f__Gemmatimonadaceae; g__Gemmatimonas; s__unclassified
OTU6330.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Porphyromonadaceae; g__Paludibacter; s__unclassified
OTU6340.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU6350.000.000.000.000.000.001.000.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__succinicans
OTU6360.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6370.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Pedobacter; s__unclassified
OTU6380.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6390.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Elusimicrobia; c__Elusimicrobia; o__MVP-88; f__unclassified; g__unclassified; s__unclassified
OTU6400.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Mucilaginibacter; s__Mucilaginibacter lutimaris
OTU6410.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU6420.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Hymenobacter; s__unclassified
OTU6430.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Dyadobacter; s__unclassified
OTU6440.000.000.000.000.000.002.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__Flavobacterium granuli
OTU6450.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__unclassified; s__unclassified
OTU6460.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Porphyromonadaceae; g__Dysgonomonas; s__unclassified
OTU6471.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6480.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Sphingobacterium; s__Sphingobacterium nematocida
OTU6490.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6500.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria-6; o__iii1-15; f__unclassified; g__unclassified; s__unclassified
OTU6510.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Bacteroidaceae; g__Bacteroides; s__Bacteroides coprosuis
OTU6521.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Porphyromonadaceae; g__Porphyromonas; s__Porphyromonas bennonis
OTU6531.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Hymenobacter; s__unclassified
OTU6540.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Hymenobacter; s__unclassified
OTU6550.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6560.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Porphyromonadaceae; g__Barnesiella; s__unclassified
OTU6570.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Porphyromonadaceae; g__unclassified; s__unclassified
OTU6580.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Porphyromonadaceae; g__Dysgonomonas; s__unclassified
OTU6591.000.000.000.000.000.000.002.000.000.002.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU6600.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6610.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU6620.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Chloroflexi; c__C0119; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU6630.003.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Cytophagia; o__Cytophagales; f__Cytophagaceae; g__Dyadobacter; s__unclassified
OTU6640.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU6650.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6660.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Sphingobacteriaceae; g__Pedobacter; s__unclassified
OTU6671.000.000.000.000.000.001.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6681.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6691.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__Flavobacterium suncheonense
OTU6700.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Prevotellaceae; g__unclassified; s__unclassified
OTU6710.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__S24-7; g__unclassified; s__unclassified
OTU6720.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp18; o__Gp18; f__Gp18; g__Gp18; s__unclassified
OTU6730.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Chlorobi; c__BSV26; o__PK329; f__unclassified; g__unclassified; s__unclassified
OTU6740.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__Flavobacterium soli
OTU6750.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Corynebacteriaceae; g__Corynebacterium; s__unclassified
OTU6760.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6770.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__Chitinophagaceae; g__Segetibacter; s__Segetibacter aerophilus
OTU6780.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU6790.000.000.000.000.000.000.002.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6800.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__unclassified; s__unclassified
OTU6810.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Bacteroidaceae; g__Bacteroides; s__Bacteroides heparinolyticus
OTU6820.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__unclassified; s__unclassified
OTU6830.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__unclassified
OTU6840.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Sphingobacteriia; o__Sphingobacteriales; f__unclassified; g__unclassified; s__unclassified
OTU6850.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Chryseobacterium; s__unclassified
OTU6860.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__Flavobacterium macrobrachii
OTU6870.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Deinococcus-Thermus; c__Deinococci; o__Deinococcales; f__Deinococcaceae; g__Deinococcus; s__unclassified
OTU6880.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU6890.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__Porphyromonadaceae; g__unclassified; s__unclassified
OTU6900.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Wautersiella; s__unclassified
OTU6911.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Fibrobacteres; c__Fibrobacteria; o__Fibrobacterales; f__Fibrobacteraceae; g__Fibrobacter; s__unclassified
OTU6920.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Deinococcus-Thermus; c__Deinococci; o__Deinococcales; f__Deinococcaceae; g__Deinococcus; s__Deinococcus xibeiensis
OTU6931.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Aminicenantes; c__Aminicenantes_genera_incertae_sedis; o__Aminicenantes_genera_incertae_sedis; f__Aminicenantes_genera_incertae_sedis; g__Aminicenantes_genera_incertae_sedis; s__unclassified
OTU69427.0027.0039.0034.0036.0043.0033.0026.0033.0035.0025.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU695101.00132.000.005.001.00144.00122.0095.000.00200.0057.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU6960.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__FBP; c__unclassified; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU6970.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU6980.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Gemmatimonadetes; c__Gemm-1; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU6990.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Deinococcus-Thermus; c__Deinococci; o__Deinococcales; f__Deinococcaceae; g__Deinococcus; s__Deinococcus gobiensis
OTU7001.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Deinococcus-Thermus; c__Deinococci; o__Deinococcales; f__Deinococcaceae; g__Deinococcus; s__Deinococcus geothermalis
OTU7010.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Aminicenantes; c__Aminicenantes_genera_incertae_sedis; o__Aminicenantes_genera_incertae_sedis; f__Aminicenantes_genera_incertae_sedis; g__Aminicenantes_genera_incertae_sedis; s__unclassified
OTU7020.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7030.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Planctomycetes; c__Planctomycetia; o__Planctomycetales; f__Planctomycetaceae; g__unclassified; s__unclassified
OTU7040.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7050.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Microbacteriaceae; g__Rathayibacter; s__caricis
OTU7061.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU70719.0019.0018.0028.0011.0029.0029.0036.0019.0019.006.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Micrococcaceae; g__Rothia; s__unclassified
OTU7081.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Deinococcus-Thermus; c__Deinococci; o__Thermales; f__Thermaceae; g__Thermus; s__Thermus scotoductus
OTU7090.000.001.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Carludovica; s__palmata
OTU7100.000.000.000.000.000.001.000.001.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Geodermatophilaceae; g__Geodermatophilus; s__unclassified
OTU7114.003.001.003.005.007.005.005.002.003.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Micrococcaceae; g__Arthrobacter; s__unclassified
OTU7120.000.001.001.000.000.000.000.001.003.001.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Intrasporangiaceae; g__Phycicoccus; s__unclassified
OTU713130.0092.00100.0072.0039.00191.0065.00258.0067.0063.0019.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Arabidopsis; s__thaliana
OTU7140.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Coriobacteriales; f__Coriobacteriaceae; g__unclassified; s__unclassified
OTU71516910.0016113.0014588.0016447.0014511.0022261.0016704.0015904.0013413.0016329.008670.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7160.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU717183.00109.00184.0097.0054.00219.00145.00252.0078.0095.0032.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Raphanus; s__sativus
OTU7184.0022.0014.0041.00107.0041.0046.0062.0025.0080.009.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7190.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7201.000.004.000.002.000.000.000.006.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7210.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7220.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Fusobacteria; c__Fusobacteriia; o__Fusobacteriales; f__Fusobacteriaceae; g__Fusobacterium; s__Fusobacterium necrophorum
OTU7230.000.000.000.000.000.000.001.000.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU7240.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Kineosporiaceae; g__Angustibacter; s__unclassified
OTU7250.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Promicromonosporaceae; g__Luteimicrobium; s__subarcticum
OTU7260.000.000.000.000.001.000.001.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Corynebacteriaceae; g__Corynebacterium; s__variabile
OTU7270.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Pseudonocardiaceae; g__Pseudonocardia; s__unclassified
OTU7280.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Cellulomonadaceae; g__Cellulomonas; s__unclassified
OTU7290.000.000.001.000.000.001.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Nocardioidaceae; g__Aeromicrobium; s__unclassified
OTU7301.000.000.001.000.001.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Microbacteriaceae; g__unclassified; s__unclassified
OTU7311.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Nocardiaceae; g__Rhodococcus; s__unclassified
OTU7320.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7330.000.000.000.001.000.000.000.002.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7340.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7350.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7360.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Carludovica; s__palmata
OTU7370.000.005.008.009.002.000.000.0039.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7380.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7390.000.001.001.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7400.000.000.001.000.000.002.001.001.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7410.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7420.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7430.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU7441.000.000.000.000.001.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7450.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7460.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7470.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7480.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7490.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU7500.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7510.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7520.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7530.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7540.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7550.000.00123.00102.00156.005.006.000.0060.001.004.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7560.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7570.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7580.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7590.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7600.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7610.000.001.001.000.001.000.008.001.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__johnsonii
OTU7620.000.000.000.000.001.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU7630.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7640.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7650.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU7660.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7670.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7680.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU7690.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7700.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7711.000.000.000.000.001.002.001.001.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU7720.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7730.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7740.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7750.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__WS3; c__PRR-12; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU7760.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__ML635J-21; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU7770.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteriia; o__Acidobacteriales; f__Koribacteraceae; g__unclassified; s__unclassified
OTU7780.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__unclassified
OTU7790.000.000.000.000.000.000.001.001.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU7800.001.000.000.000.000.001.000.001.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU7810.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7820.001.000.000.000.002.000.002.000.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU7830.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Microbacteriaceae; g__Leucobacter; s__unclassified
OTU7840.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7850.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7860.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Gemmatimonadetes; c__Gemm-1; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU7870.000.002.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7880.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7890.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7900.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7910.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU7920.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU7930.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU7940.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7950.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7960.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7970.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7980.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU7990.000.001.000.000.001.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8000.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8010.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU80210.006.004.004.002.0014.006.0015.000.004.001.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Oryza; s__sativa Indica Group
OTU8030.001.001.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8040.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8050.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8060.001.001.000.000.000.000.000.000.000.002.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8070.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8080.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8090.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8100.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8110.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8120.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8130.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8140.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8150.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8160.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8170.000.001.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8180.001.001.000.003.002.000.001.000.001.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8190.000.004.000.001.003.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Brenneria; s__alni
OTU8200.000.001.002.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8211.000.001.001.001.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8220.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Arabidopsis; s__thaliana
OTU8230.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8240.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8250.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8260.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8270.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8280.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8290.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8300.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8310.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8320.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU8330.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8340.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8350.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8360.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8370.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8380.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8390.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8400.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8410.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU8420.000.000.001.000.000.000.000.000.000.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Enhydrobacter; s__unclassified
OTU8430.001.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Fusobacteria; c__Fusobacteriia; o__Fusobacteriales; f__Fusobacteriaceae; g__unclassified; s__unclassified
OTU8442.000.000.000.000.002.001.000.002.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Caulobacterales; f__Caulobacteraceae; g__Brevundimonas; s__unclassified
OTU8452.001.000.007.006.000.004.003.0010.004.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Methylobacteriaceae; g__Methylobacterium; s__adhaesivum
OTU8462.000.000.000.000.000.000.000.001.002.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Brucellaceae; g__Ochrobactrum; s__pseudogrignonense
OTU8475.005.005.0016.0018.005.0011.007.006.009.005.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Rhizobiaceae; g__Rhizobium; s__unclassified
OTU8482.009.005.007.0012.003.004.008.0011.002.001.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingomonas; s__unclassified
OTU8490.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8501.001.000.000.000.001.001.000.002.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8510.001.001.002.000.002.002.002.001.000.002.00d__Bacteria; p__Proteobacteria; c__Epsilonproteobacteria; o__Campylobacterales; f__Campylobacteraceae; g__Arcobacter; s__unclassified
OTU8520.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingobium; s__unclassified
OTU8531.000.002.001.000.001.003.001.001.001.000.00d__Bacteria; p__Proteobacteria; c__Epsilonproteobacteria; o__Campylobacterales; f__Campylobacteraceae; g__Arcobacter; s__unclassified
OTU8540.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__unclassified; g__unclassified; s__unclassified
OTU8550.000.000.001.003.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8560.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8570.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8580.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8590.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8600.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Candidatus Saccharibacteria; c__Saccharibacteria_genera_incertae_sedis; o__Saccharibacteria_genera_incertae_sedis; f__Saccharibacteria_genera_incertae_sedis; g__Saccharibacteria_genera_incertae_sedis; s__unclassified
OTU8610.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8620.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8630.000.000.000.002.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8640.000.000.000.001.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8650.002.001.002.003.000.001.005.000.002.004.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8660.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8670.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8680.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8690.003.000.0010.0010.0016.0012.0064.000.0016.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU8700.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8710.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8720.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8730.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8740.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU8750.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8760.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8770.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8780.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8790.001.000.000.001.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU8800.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8810.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU8820.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8830.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8840.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8850.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8860.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8870.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8880.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8890.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8900.001.000.001.003.003.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8910.000.000.001.001.000.001.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8920.000.000.000.001.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8930.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8940.000.000.000.001.001.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8950.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8960.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8970.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU8980.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU8990.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9000.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9010.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9020.000.000.000.001.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9030.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU9040.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9050.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9060.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9070.000.000.000.001.000.000.002.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9080.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9090.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9100.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9110.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9120.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9130.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9140.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9150.000.000.000.001.001.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9160.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9170.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9180.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9190.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9200.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9210.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9220.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9230.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9240.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9250.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9260.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9270.000.000.000.000.001.000.003.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__unclassified
OTU9280.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Carludovica; s__palmata
OTU9290.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9300.000.001.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Carludovica; s__palmata
OTU9310.000.000.000.000.000.002.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Micrococcaceae; g__Kocuria; s__unclassified
OTU9320.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU9330.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Acidaminobacteraceae; g__Fusibacter; s__unclassified
OTU9341.000.000.002.000.004.002.002.000.000.004.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU9350.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9360.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9370.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9380.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9390.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9400.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9410.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9420.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9430.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9440.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9450.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9460.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9470.000.000.002.000.000.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__unclassified; s__unclassified
OTU9480.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9490.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9500.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9510.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9520.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9530.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9540.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9550.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9560.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9570.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9580.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9591.000.000.002.000.002.001.001.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU9600.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9610.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU9620.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9630.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9640.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU9650.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9660.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9670.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU9680.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9690.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9700.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9710.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9720.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU9730.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9740.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9750.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9760.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9770.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9780.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9790.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9800.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9810.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9820.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9830.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9840.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9850.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9860.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9870.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9880.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9890.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9900.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9910.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9920.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__unclassified
OTU9930.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9940.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU9950.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9960.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9970.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU9981.000.001.001.001.001.000.000.001.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU9990.000.000.000.000.000.000.000.001.000.000.00d__Bacteria; p__Proteobacteria; c__Epsilonproteobacteria; o__Campylobacterales; f__Campylobacteraceae; g__Sulfurospirillum; s__unclassified
OTU10000.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Parcubacteria; c__Parcubacteria_genera_incertae_sedis; o__Parcubacteria_genera_incertae_sedis; f__Parcubacteria_genera_incertae_sedis; g__Parcubacteria_genera_incertae_sedis; s__unclassified
OTU10010.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Aeromonadales; f__Aeromonadaceae; g__unclassified; s__unclassified
OTU10020.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Nocardioidaceae; g__Nocardioides; s__unclassified
OTU10030.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10040.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Acidimicrobiales; f__unclassified; g__unclassified; s__unclassified
OTU10050.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU10060.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU10070.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10080.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10090.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10101.001.000.001.001.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU10111.001.000.000.000.005.000.001.000.004.002.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10120.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__4C0d-2; o__MLE1-12; f__unclassified; g__unclassified; s__unclassified
OTU10130.004.003.004.002.001.004.005.000.001.001.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Methylobacteriaceae; g__Methylobacterium; s__adhaesivum
OTU10140.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhodospirillales; f__Acetobacteraceae; g__Acetobacter; s__unclassified
OTU10150.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Alsobacter_family; g__Alsobacter; s__Alsobacter metallidurans
OTU10160.000.001.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhodobacterales; f__Rhodobacteraceae; g__Rhodobacter; s__unclassified
OTU10171.000.001.000.000.002.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Hyphomicrobiaceae; g__Devosia; s__unclassified
OTU10180.000.001.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingomonas; s__wittichii
OTU10190.001.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhodospirillales; f__Acetobacteraceae; g__Roseomonas; s__unclassified
OTU10200.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10210.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Novosphingobium; s__capsulatum
OTU10220.000.001.000.000.001.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Rhizobiaceae; g__Agrobacterium; s__unclassified
OTU10231.000.002.001.000.000.001.005.000.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Raphanus; s__sativus
OTU10240.002.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Intrasporangiaceae; g__Terrabacter; s__unclassified
OTU10250.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__unclassified; g__unclassified; s__unclassified
OTU10260.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Nocardiaceae; g__Rhodococcus; s__fascians
OTU10270.000.000.001.000.002.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10280.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10290.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10300.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10310.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10320.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10330.000.000.000.000.000.000.000.001.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhodobacterales; f__Rhodobacteraceae; g__Pseudoruegeria; s__aquimaris
OTU10341.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Micrococcaceae; g__Rothia; s__unclassified
OTU10350.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10360.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Bdellovibrionales; f__Bdellovibrionaceae; g__Bdellovibrio; s__unclassified
OTU10371.001.000.000.000.000.001.005.000.000.002.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU10380.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU10390.000.000.001.001.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingomonas; s__unclassified
OTU10404.005.000.007.003.005.008.0010.000.004.002.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingomonas; s__unclassified
OTU10410.000.000.000.001.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10420.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp16; o__Gp16; f__Gp16; g__Gp16; s__unclassified
OTU10430.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp16; o__Gp16; f__Gp16; g__Gp16; s__unclassified
OTU10441.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingomonas; s__unclassified
OTU10450.000.000.000.001.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU10461.000.000.000.001.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Methylobacteriaceae; g__Methylobacterium; s__unclassified
OTU10470.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10480.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10490.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10500.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10510.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10520.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10530.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Arabidopsis; s__thaliana
OTU10540.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU10550.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10560.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU10570.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10580.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10590.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10600.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10610.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10620.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10630.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10640.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU10650.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU10660.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10670.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10680.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10690.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10700.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10710.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Xanthomonas; s__campestris
OTU10720.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10730.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10740.000.000.000.000.001.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Aeromonadales; f__Aeromonadaceae; g__Tolumonas; s__unclassified
OTU10750.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10760.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10771.001.000.000.000.003.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__unclassified; s__unclassified
OTU10780.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10790.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10800.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10810.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10820.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10830.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10840.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10850.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10860.001.000.000.000.002.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Leuconostocaceae; g__Leuconostoc; s__unclassified
OTU10870.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10880.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU10890.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10900.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10910.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10920.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10930.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10940.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10950.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10960.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10970.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10980.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU10990.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11000.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11010.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11029.009.000.000.000.007.0014.0011.000.006.0011.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11030.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11040.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Acidovorax; s__unclassified
OTU11050.000.000.000.000.001.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11060.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__unclassified; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU11070.001.000.000.000.001.003.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11080.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11090.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11100.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11110.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11120.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11130.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11140.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11150.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11160.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11170.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11180.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11190.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11200.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11210.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11220.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11230.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11240.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU11250.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11260.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11270.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11280.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11290.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11300.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11310.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11320.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11330.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11340.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11350.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11360.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU11370.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Peptostreptococcaceae; g__Proteocatella; s__unclassified
OTU11380.000.000.000.000.000.002.000.000.000.000.00d__Bacteria; p__Fusobacteria; c__Fusobacteriia; o__Fusobacteriales; f__Fusobacteriaceae; g__Fusobacterium; s__unclassified
OTU11390.003.000.003.000.003.003.002.000.004.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Caulobacterales; f__Caulobacteraceae; g__Brevundimonas; s__unclassified
OTU11400.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp16; o__Gp16; f__Gp16; g__Gp16; s__unclassified
OTU11410.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Phyllobacteriaceae; g__unclassified; s__unclassified
OTU11420.000.000.001.000.000.000.001.000.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Aurantimonadaceae; g__Aurantimonas; s__ureilytica
OTU11430.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Bradyrhizobiaceae; g__Bosea; s__unclassified
OTU11444.001.000.001.000.005.000.007.000.002.002.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingomonas; s__unclassified
OTU11450.000.000.001.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Caulobacterales; f__Caulobacteraceae; g__Brevundimonas; s__diminuta
OTU11460.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingomonas; s__unclassified
OTU11470.000.000.001.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp16; o__Gp16; f__Gp16; g__Gp16; s__unclassified
OTU11481.000.000.000.000.000.000.002.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11490.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Vibrionales; f__Vibrionaceae; g__Lucibacterium; s__unclassified
OTU11500.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU11510.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11520.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11530.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11540.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11550.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11560.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11570.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU11580.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11590.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11600.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11610.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11620.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11630.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11640.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11650.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU11660.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11670.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11680.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11690.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11700.001.000.000.000.000.001.000.000.001.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11710.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11720.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11730.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11740.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU11750.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11760.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11770.001.000.000.000.000.000.002.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__viridiflava
OTU11780.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11790.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11800.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11810.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11820.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11830.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11840.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11850.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11860.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11871.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU11880.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11890.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__fragi
OTU11900.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11910.002.000.000.000.000.000.000.000.001.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11920.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11930.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11940.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11950.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11960.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11970.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11980.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU11990.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12000.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12010.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Epsilonproteobacteria; o__Campylobacterales; f__Campylobacteraceae; g__Arcobacter; s__unclassified
OTU12020.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12030.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12040.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12050.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12060.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12070.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__succinicans
OTU12080.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU12090.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12100.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12110.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12120.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU12130.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Carludovica; s__palmata
OTU12140.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12150.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12160.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__AD3; c__ABS-6; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU12170.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU12180.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Kineosporiaceae; g__Quadrisphaera; s__granulorum
OTU12190.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Dermabacteraceae; g__Brachybacterium; s__unclassified
OTU12200.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Oryza; s__sativa Indica Group
OTU12210.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12220.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12230.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12240.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12250.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12260.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Oxalobacteraceae; g__Janthinobacterium; s__unclassified
OTU12270.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12280.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12290.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Pseudomonadaceae; g__Pseudomonas; s__unclassified
OTU12300.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12310.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12320.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12330.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12341.000.000.000.000.000.002.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12350.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12360.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12370.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU12380.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12390.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12400.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12410.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12420.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12430.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12440.000.000.000.000.000.001.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Methylobacteriaceae; g__Methylobacterium; s__adhaesivum
OTU12450.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12460.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12470.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12480.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12491.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU12500.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12510.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12520.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12530.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12540.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12550.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12560.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12570.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12580.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12590.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12600.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU12610.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12620.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12630.000.000.000.000.000.001.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU12640.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12650.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12660.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12670.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12680.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12690.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12700.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Rhizobiaceae; g__Agrobacterium; s__unclassified
OTU12710.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12720.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12730.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12740.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12750.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12760.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12771.001.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__WPS-2; c__unclassified; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU12780.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12790.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12800.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Chloroflexi; c__Anaerolineae; o__Anaerolineales; f__Anaerolineaceae; g__unclassified; s__unclassified
OTU12810.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12820.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12830.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Chloroflexi; c__Anaerolineae; o__Anaerolineales; f__Anaerolineaceae; g__unclassified; s__unclassified
OTU12840.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Lactococcus; s__unclassified
OTU12850.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp3; o__Gp3; f__Gp3; g__Gp3; s__unclassified
OTU12860.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12870.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Candidatus Saccharibacteria; c__Saccharibacteria_genera_incertae_sedis; o__Saccharibacteria_genera_incertae_sedis; f__Saccharibacteria_genera_incertae_sedis; g__Saccharibacteria_genera_incertae_sedis; s__unclassified
OTU12880.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12890.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12900.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Neisseriales; f__Neisseriaceae; g__Vogesella; s__unclassified
OTU12910.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12920.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12930.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12940.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12950.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12960.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12970.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12980.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU12990.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13000.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13010.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13020.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13030.002.000.000.000.000.000.0010.000.000.003.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13040.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13050.000.000.000.000.000.000.001.000.000.001.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingomonas; s__unclassified
OTU13060.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13070.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__johnsonii
OTU13080.000.000.000.000.000.001.001.000.000.001.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae; g__Xanthomonas; s__campestris
OTU13090.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13100.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13110.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Raphanus; s__sativus
OTU13120.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13130.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13140.000.000.000.000.000.000.001.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13150.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13160.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13170.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13180.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13190.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13200.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13210.000.000.000.001.000.000.000.000.000.000.00d__Bacteria; p__Deinococcus-Thermus; c__Deinococci; o__Deinococcales; f__Trueperaceae; g__Truepera; s__unclassified
OTU13220.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Rhizobiaceae; g__Rhizobium; s__unclassified
OTU13230.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Arabidopsis; s__thaliana
OTU13241.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Carludovica; s__palmata
OTU13250.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__unclassified; g__unclassified; s__unclassified
OTU13261.000.000.000.000.001.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Methylobacteriaceae; g__Methylobacterium; s__unclassified
OTU13270.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Natranaerovirga; g__Natranaerovirga; s__unclassified
OTU13280.000.000.000.000.001.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Enhydrobacter; s__unclassified
OTU13290.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Kaistobacter; s__unclassified
OTU13300.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhodobacterales; f__Rhodobacteraceae; g__unclassified; s__unclassified
OTU13310.001.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Clostridiaceae 1; g__Clostridium sensu stricto; s__unclassified
OTU13320.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Lachnospiraceae; g__unclassified; s__unclassified
OTU13330.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Methylobacteriaceae; g__Microvirga; s__unclassified
OTU13340.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU13350.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU13360.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13370.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13380.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU13390.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13400.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13410.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13420.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13430.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13440.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13450.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13460.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13470.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13480.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13490.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13500.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13510.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13520.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13530.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13540.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13550.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU13560.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13570.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13580.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13590.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13600.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13610.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13620.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13630.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Candidatus Saccharibacteria; c__Saccharibacteria_genera_incertae_sedis; o__Saccharibacteria_genera_incertae_sedis; f__Saccharibacteria_genera_incertae_sedis; g__Saccharibacteria_genera_incertae_sedis; s__unclassified
OTU13640.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13650.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13660.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13670.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingomonas; s__unclassified
OTU13680.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13690.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13700.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13710.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13720.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU13730.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13740.001.000.000.000.000.001.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13750.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__unclassified
OTU13760.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Bacilli; o__Lactobacillales; f__Streptococcaceae; g__Streptococcus; s__unclassified
OTU13771.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13781.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13791.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13801.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13811.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13821.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13831.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13841.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13851.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13861.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13871.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13881.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13891.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Carludovica; s__palmata
OTU13901.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13911.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13921.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13931.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13941.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13951.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13961.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13971.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU13984.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU13991.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14001.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14011.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14021.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14031.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14041.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14052.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14061.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14071.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14081.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14091.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14101.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14111.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14121.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14131.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14141.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14151.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14161.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14171.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14181.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14191.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14201.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14211.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14221.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14231.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14241.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Candidatus Saccharibacteria; c__Saccharibacteria_genera_incertae_sedis; o__Saccharibacteria_genera_incertae_sedis; f__Saccharibacteria_genera_incertae_sedis; g__Saccharibacteria_genera_incertae_sedis; s__unclassified
OTU14251.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14261.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14271.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU14281.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14291.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14301.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14311.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14321.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14331.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14341.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14351.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14360.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp1; o__Gp1; f__Gp1; g__Gp1; s__unclassified
OTU14370.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Clostridiaceae 1; g__Clostridium sensu stricto; s__unclassified
OTU14380.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Bradyrhizobiaceae; g__Bradyrhizobium; s__unclassified
OTU14390.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingomonas; s__unclassified
OTU14400.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14410.000.000.000.000.000.000.002.000.001.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Lachnospiraceae; g__unclassified; s__unclassified
OTU14421.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Nitrospirae; c__Nitrospira; o__Nitrospirales; f__Thermodesulfovibrionaceae; g__GOUTA19; s__unclassified
OTU14430.000.000.000.000.000.000.001.000.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhodobacterales; f__Rhodobacteraceae; g__unclassified; s__unclassified
OTU14440.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14450.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14460.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Acidimicrobiales; f__Acidimicrobiaceae; g__Ilumatobacter; s__unclassified
OTU14470.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14480.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14491.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp4; o__Gp4; f__Gp4; g__Gp4; s__unclassified
OTU14500.000.000.000.000.000.002.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Lachnospiraceae; g__unclassified; s__unclassified
OTU14510.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhodospirillales; f__Acetobacteraceae; g__Roseococcus; s__unclassified
OTU14520.000.000.000.000.000.001.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU14530.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Hyphomicrobiaceae; g__Rhodoplanes; s__unclassified
OTU14540.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Rhizobiaceae; g__unclassified; s__unclassified
OTU14550.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Clostridiaceae 1; g__unclassified; s__unclassified
OTU14560.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Rhizobiaceae; g__Rhizobium; s__unclassified
OTU14570.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Epsilonproteobacteria; o__Campylobacterales; f__Campylobacteraceae; g__Sulfurospirillum; s__unclassified
OTU14580.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingomonas; s__unclassified
OTU14591.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU14601.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp4; o__Gp4; f__Gp4; g__Gp4; s__unclassified
OTU14611.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria; c__unclassified; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU14621.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14631.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU14641.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14650.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Chloroflexi; c__TK10; o__B07_WMSP1; f__unclassified; g__unclassified; s__unclassified
OTU14660.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU14670.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Nitrospirae; c__Nitrospira; o__Nitrospirales; f__Thermodesulfovibrionaceae; g__GOUTA19; s__unclassified
OTU14680.000.000.000.000.000.000.000.000.001.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__unclassified; f__unclassified; g__unclassified; s__unclassified
OTU14690.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp3; o__Gp3; f__Gp3; g__Gp3; s__unclassified
OTU14700.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Nitrospirae; c__Nitrospira; o__Nitrospirales; f__Thermodesulfovibrionaceae; g__unclassified; s__unclassified
OTU14710.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14720.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Lachnospiraceae; g__Clostridium XlVa; s__unclassified
OTU14730.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14740.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14750.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14760.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14770.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14780.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14790.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14800.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14810.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU14820.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14830.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14840.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14850.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14860.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14870.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Micrococcaceae; g__unclassified; s__unclassified
OTU14880.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14890.000.000.000.000.000.000.009.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU14900.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__Citrobacter; s__gillenii
OTU14910.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14920.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14930.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Pseudomonadales; f__Moraxellaceae; g__Acinetobacter; s__unclassified
OTU14940.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14950.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14960.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14970.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Acidaminobacteraceae; g__Fusibacter; s__unclassified
OTU14980.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU14990.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15000.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Candidatus Saccharibacteria; c__Saccharibacteria_genera_incertae_sedis; o__Saccharibacteria_genera_incertae_sedis; f__Saccharibacteria_genera_incertae_sedis; g__Saccharibacteria_genera_incertae_sedis; s__unclassified
OTU15010.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15020.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15030.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU15040.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15050.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15060.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15070.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15080.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15090.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15100.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15110.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Ruminococcaceae; g__Oscillibacter; s__unclassified
OTU15120.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15130.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15140.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15150.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15160.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Micrococcaceae; g__unclassified; s__unclassified
OTU15170.000.000.000.000.000.000.002.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Raphanus; s__sativus
OTU15180.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15190.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15200.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15210.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU15220.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15230.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15240.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15250.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU15260.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15270.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp16; o__Gp16; f__Gp16; g__Gp16; s__unclassified
OTU15280.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Rhizobiaceae; g__Kaistia; s__Kaistia terrae
OTU15290.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Peptostreptococcaceae; g__Sporacetigenium; s__Sporacetigenium mesophilum
OTU15300.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Caulobacterales; f__Caulobacteraceae; g__Phenylobacterium; s__unclassified
OTU15310.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Hyphomicrobiaceae; g__Pedomicrobium; s__unclassified
OTU15320.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhodospirillales; f__unclassified; g__unclassified; s__unclassified
OTU15330.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__unclassified; g__unclassified; s__unclassified
OTU15340.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp16; o__Gp16; f__Gp16; g__Gp16; s__unclassified
OTU15350.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Myxococcales; f__Cystobacteraceae; g__Anaeromyxobacter; s__unclassified
OTU15360.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Rhizobiaceae; g__Agrobacterium; s__unclassified
OTU15370.001.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhodospirillales; f__Rhodospirillaceae; g__unclassified; s__unclassified
OTU15381.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__unclassified; g__unclassified; s__unclassified
OTU15391.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Acidobacteria; c__Acidobacteria_Gp16; o__Gp16; f__Gp16; g__Gp16; s__unclassified
OTU15402.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhodobacterales; f__Rhodobacteraceae; g__Paracoccus; s__unclassified
OTU15411.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingobium; s__unclassified
OTU15421.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__BD7-3; f__unclassified; g__unclassified; s__unclassified
OTU15431.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Ruminococcaceae; g__Clostridium III; s__unclassified
OTU15440.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__S24-7; g__unclassified; s__unclassified
OTU15450.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15460.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15470.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__unclassified; g__unclassified; s__unclassified
OTU15480.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Carludovica; s__palmata
OTU15490.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15500.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Candidatus Saccharibacteria; c__Saccharibacteria_genera_incertae_sedis; o__Saccharibacteria_genera_incertae_sedis; f__Saccharibacteria_genera_incertae_sedis; g__Saccharibacteria_genera_incertae_sedis; s__unclassified
OTU15510.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__unclassified; s__unclassified
OTU15520.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU15530.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU15540.001.000.000.000.000.000.002.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU15550.000.000.000.000.000.001.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15561.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Ruminococcaceae; g__unclassified; s__unclassified
OTU15571.000.000.000.000.000.000.000.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Clostridiales_Incertae Sedis XI; g__Finegoldia; s__unclassified
OTU15580.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Actinobacteria; c__Actinobacteria; o__Actinomycetales; f__Micrococcaceae; g__Arthrobacter; s__nicotinovorans
OTU15590.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU15600.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingobium; s__unclassified
OTU15610.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Epsilonproteobacteria; o__Campylobacterales; f__Helicobacteraceae; g__Helicobacter; s__Helicobacter rodentium
OTU15620.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU15630.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Sphingomonas; s__unclassified
OTU15640.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU15650.001.000.000.000.001.000.001.000.000.000.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified
OTU15660.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Sphingomonadales; f__Sphingomonadaceae; g__Novosphingobium; s__unclassified
OTU15670.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__S24-7; g__unclassified; s__unclassified
OTU15680.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Arabidopsis; s__thaliana
OTU15690.000.001.000.000.000.000.000.000.000.000.00d__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rickettsiales; f__mitochondria; g__Zea; s__luxurians
OTU15700.000.000.000.000.000.000.001.000.000.000.00d__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Ruminococcaceae; g__unclassified; s__unclassified
OTU15710.000.000.000.000.001.000.000.000.000.000.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15720.000.000.000.000.000.000.000.000.000.001.00d__Bacteria; p__Cyanobacteria/Chloroplast; c__Chloroplast; o__Chloroplast; f__Chloroplast; g__Streptophyta; s__unclassified
OTU15730.001.000.001.001.000.000.002.001.000.001.00d__Bacteria; p__Cyanobacteria; c__Chloroplast; o__Streptophyta; f__unclassified; g__unclassified; s__unclassified

ps: The table shows the tag number and the species of each OTU. Only partial results are presented due to limited space in the report.


The full table can be found in src/summary_report/06_ taxonomy_community/01_OTU_expression_taxonomy.xlsx


7.2 Taxa Summary

After mapping OTU tags to the three databases,taxonomy results are shown as follows.


(1) Area Charts



Figure 11: Area Charts of Taxanomy


ps: Area charts show the ratio of the abundance in each taxon to the total abundance for each sample. The abundance is derived by the number of tags shown in the table.


The charts can also be found in src/summary_report/06_taxonomy_community/02_taxa_summary/area_charts.html


(2) Bar Charts



Figure 12: Bar Charts of Taxanomy


ps: Bar charts show the ratio of the abundance in each taxon to the total abundance for each sample. The abundance is derived by the number of tags shown in the table.


The charts can also be found in src/summary_report/06_taxonomy_community/02_taxa_summary/bar_charts.html


(3) Pie Charts



Figure 13: Pie Charts of Taxanomy


ps: Two pie charts are plotted for each sample. The first chart includes all species, and the second chart includes the top 20 species. The number of tags and the percentage of tags are shown in the table for each sample.


The charts can also be found in src/summary_report/06_taxonomy_community/02_taxa_summary/pie_charts.html


ps: The results are presented in terms of the taxanomy level, and can be viewed using the Chrome browser.


7.3 Taxa Heatmap


The Heatmap shows the expression level of taxanomy units in each sample. The color key in the heatmap represents the relative abundance calculated by the number of tags. The trees next the heatmap shows the results of clustering based on the abundance in terms of samples (at the horizontal side) and taxanomy units (at the vertial side).


Figure 14: Taxa Heatmaps







ps: The heatmaps are plotted in 7 taxanomy levels.


The full set of heatmaps can also be found in src/summary_report/06_taxonomy_community/03_taxa_heatmap


7.4 Taxa Phylogeny


The phylogenetic tree shows the phylogenesis among species. The tree is composed of nodes and branches. Each node represents a taxanomic unit (from phylum through genus), and the branch denotes the phylogenetic relation between nodes.




Figure 15: Taxa Phylogeny







ps: The green area covers taxa having a low abundance; the red area covers taxa having a high abundance. The node size denotes the abundance of the taxanomy unit. The taxa are annoated around the tree.


The figure can also be found in src/summary_report/06_taxonomy _community/04_taxa_phylogeny


7.5 Metastats


Metastats[19] provides differrenital expression analysis between samples using a non parametric t-test and Fisher's exact test. The analysis is done for each taxanomy level. The p-value and the False Discovery Rate (FDR) adjusted p-value are reported to determine significant difference.


Description of Headers:


Header Description
name_of_feature Taxon name
mean(group_1) Mean of abundance in group 1
variance(group_1) Variance of abundance in group 1
standard_error(group_1) Standard error of abundance in group 1
mean(group_2) Mean of abundance in group 2
variance(group_2) Variance of abundance in group 2
standard_error(group_2) Standard error of abundance in group 2
p_value original p-value
q_value FDR adjusted p-value

The results can also be found in src/summary_report/06_taxonomy _community/05_metastats




References


[1] James R. Cole, Qiong Wang, Jordan A. Fish, Benli Chai, Donna M. McGarrell, Yanni Sun, C. Titus Brown,Andrea Porras-Alfaro, Cheryl R. Kuske, and James M. Tiedje. Ribosomal database project: data and tools forhigh throughput rrna analysis. Nucleic Acids Research, 42(D1):D633{D642, 2014.

[2] T. Z. DeSantis, P. Hugenholtz, N. Larsen, M. Rojas, E. L. Brodie, K. Keller, T. Huber, D. Dalevi, P. Hu, and G. L. Andersen. Greengenes, a chimera-checked 16S rrna gene database and workbench compatible with arb.Applied and Environmental Microbiology, 72(7):5069{5072, 2006.

[3] Tanja Magoc and Steven L. Salzberg. Flash: Fast length adjustment of short reads to improve genome assemblies.Bioinformatics, 2011.

[4] Ravi K. Patel and Mukesh Jain. Ngs qc toolkit: A toolkit for quality control of next generation sequencing data.PLoS ONE, 7(2):e30619, 02 2012.

[5] Weizhong Li and Adam Godzik. Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics, 22(13):1658{1659, 2006.

[6] Limin Fu, Beifang Niu, Zhengwei Zhu, Sitao Wu, and Weizhong Li. Cd-hit: accelerated for clustering the nextgeneration sequencing data. Bioinformatics, 28(23):3150{3152, 2012.

[7] Robert Kabacoff. R in action : data analysis and graphics with R. Manning ; Pearson Education [distributor],2011.

[8] J Gregory Caporaso, Justin Kuczynski, Jesse Stombaugh, Kyle Bittinger, Frederic D Bushman, Elizabeth K Costello, Noah Fierer, Antonio Gonzalez Pena, Julia K Goodrich, Jeffrey I Gordon, et al. Qiime allows analysis of high-throughput community sequencing data. Nature methods, 7(5):335{336, 2010.

[9] Martha I Nelson, Cecile Viboud, Amy L Vincent, Marie R Culhane, Susan E Detmer, David E Wentworth,Andrew Rambaut, Marc A Suchard, Edward C Holmes, and Philippe Lemey. Global migration of influenza a viruses in swine. Nature communications, 6, 2015.

[10] Yoshiki Vazquez-Baeza, Meg Pirrung, Antonio Gonzalez, and Rob Knight. Emperor: a tool for visualizing highthroughput microbial community data. GigaScience, 2(1):16, 2013.

[11] Qiong Wang, George M. Garrity, James M. Tiedje, and James R. Cole. Na茂ve bayesian classifier for rapid assignment of rrna sequences into the new bacterial taxonomy. Applied and Environmental Microbiology, 73(16):5261-5267, 2007.

[12] Alexander Tuzhikov, Alexander Panchin, and Valery I Shestopalov. Tuit, a blast-based tool for taxonomic classification of nucleotide sequences. Biotechniques, 56(2):78{84, 2013.

[13] Morgan GI Langille, Jesse Zaneveld, J Gregory Caporaso, Daniel McDonald, Dan Knights, Joshua A Reyes,Jose C Clemente, Deron E Burkepile, Rebecca L Vega Thurber, Rob Knight, et al. Predictive functional profiling of microbial communities using 16S rrna marker gene sequences. Nature biotechnology, 31(9):814{821, 2013.

[14] Nicola Segata, LeviWaldron, Annalisa Ballarini, Vagheesh Narasimhan, Olivier Jousson, and Curtis Huttenhower.Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods, 9(8):811-814, 2012.

[15] Daniel McDonald, Jose Clemente, Justin Kuczynski, Jai Rideout, Jesse Stombaugh, DougWendel, Andreas Wilke,Susan Huse, John Hufnagle, Folker Meyer, Rob Knight, and J Caporaso. The biological observation matrix (biom)format or: how i learned to stop worrying and love the ome-ome. GigaScience, 1(1):7, 2012.

[16] F Meyer, D Paarmann, M D'Souza, R Olson, EM Glass, M Kubal, T Paczian, A Rodriguez, R Stevens, A Wilke,J Wilkening, and RA Edwards. The metagenomics rast server - a public resource for the automatic phylogenetic and functional analysis of metagenomes. BMC Bioinformatics, 9(1):386, 2008.

[17] Catherine Lozupone, Manuel E Lladser, Dan Knights, Jesse Stombaugh, and Rob Knight. Unifrac: an effective distance metric for microbial community comparison. The ISME journal, 5(2):169, 2011.

[18] Stephen F Altschul, Thomas L Madden, Alejandro A Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J Lipman. Gapped blast and psi-blast: a new generation of protein database search programs. Nucleic acids research, 25(17):3389{3402, 1997.

[19] James Robert White, Niranjan Nagarajan, and Mihai Pop. Statistical methods for detecting differentially abundant features in clinical metagenomic samples. PLoS Comput Biol, 5(4):e1000352, 04 2009.




Appendix


Application:

1. VIM

VIM is a text editor to view sequencing data.


2、Notepad++

Notepad++ is an user friendly text editor to view sequencing data.


Supplement:

Supplement 1. FASTQ Format

Details about the FASTQ format used to save sequencing data


The files can be found at src/summary_report/07_supplemental_material